Site Loader

Содержание

Микросхемы комбинационного типа малой степени интеграции Микросхемы ТТЛ и КМОП Справочник по микросхемам ТТЛ и КМОП Любительская Радиоэлектроника

 

 Общие сведения 

   Широкое внедрение цифровой техники в радиолюбительское творчество связано с появлением интегральных микросхем. Цифровые устройства, собранные на дискретных транзисторах и диодах, имели значительные габариты и массу, ненадежно работали из-за большого количества элементов и особенно паяных соединений. Интегральные микросхемы, содержащие в своем составе десятки, сотни, тысячи, а в последнее время многие десятки и сотни тысяч и даже миллионы компонентов, позволили по-новому подойти к проектированию и изготовлению цифровых устройств. Надежность отдельной микросхемы мало зависит от количества элементов и близка к надежности одиночного транзистора, а потребляемая мощность в пересчете на отдельный компонент резко уменьшается по мере повышения степени интеграции.


В результате на интегральных микросхемах стало возможным собирать сложнейшие устройства, изготовить которые в радиолюбительских условиях без применения микросхем было бы совершенно невозможно.
Книга написана на основании большого опыта автора по изучению и применению микросхем серий ТТЛ К155, К555, КР531, КР1533, серий КМОП К176, К561, КР1554, КР1561,564 и содержит материал, частично нашедший отражение в его статьях, опубликованных в журнале <Радио>  и книгах автора. В настоящем издании описаны общие принципы функционирования комбинационных, последовательностных микросхем, ждущих мультивибраторов и генераторов, приведены схемы соединения микросхем для увеличения разрядности, фрагменты принципиальных схем цифровых устройств с применением различных описываемых микросхем, приведены описания формирователей и генераторов импульсов, квазисенсорных переключателей.
Автор надеется, что данная книга поможет многим радиолюбителям и радиоспециалистам творчески подойти к самостоятельной разработке и изготовлению многих полезных цифровых устройств.
 С. Алексеев.
 

  Микросхемы серии ТТЛ

Микросхемы комбинационного типа малой степени интеграции.

У нас в стране обширна номенклатура выпускаемых интегральных микросхем. Для построения устройств автоматики и вычислительной техники широкое применение находят цифровые микросхемы серии К 155, которые изготавливают по стандартной технологии биполярных микросхем транзисторно-транзисторной логики (ТТЛ). Имеется свыше 100 наименований микросхем серии К 155. При всех своих преимуществах — высоком быстродействии, обширной номенклатуре, хорошей помехоустойчивости — эти микросхемы обладают большой потребляемой мощностью. Поэтому им на смену выпускают микросхемы серии К555, принципиальное отличие которых — использование транзисторов с коллекторными переходами, зашунтированными диодами Шоттки. В результате транзисторы микросхем серии К555 не входят в насыщение, что существенно уменьшает задержку выключения транзисторов.

(adsbygoogle = window.adsbygoogle || []).push({}); К тому же они значительно меньших размеров, что уменьшает емкости их р-n-переходов. В результате при сохранении быстродействия микросхем серии К555 на уровне серии К155 удалось уменьшить ее потребляемую мощность примерно в 4…5 раз.

Дальнейшее развитие микросхем серий ТТЛ — разработка микросхем серии КР1533. Основное эксплуатационное отличие их от схем серии К555 — в 1.5…2 раза меньше потребляемая мощность при сохранении и повышении быстродействия.

Средняя задержка распространения элементов микросхем серии К155, К555, КР1533 примерно 15…20 нс. В случаях, когда требуется более высокое быстродействие, используют микросхемы серии КР531. Для сравнения основных параметров в табл. 1 приведены значения средней потребляемой мощности Рср и средней задержки tз.ср распространения микросхем ТТЛ указанных серий, а также стандартные значения входных Iвх и выходных Iвых токов и нагрузочной способности N указанных серий микросхем. Некоторые микросхемы допускают большие выходные токи и имеют большую нагрузочную способность, чем указано в табл. 1. Часть микросхем (особенно серии КР531) также имеют отличные от стандартных входные токи. Эти отличия специально указаны далее.

Стандартные выходные уровни лог. 1 составляют 2,4…2,7 В, лог. 0 -0,36…0,5 В.

Напряжение питания микросхем серий ТТЛ 5 В +-5%, для серии КР1533 допуск на напряжение питания +-;10%.

Микросхемы выпускают в пластмассовых корпусах с 8, 14, 16, 20, 24, 28 выводами, температурный диапазон их работоспособности:


 

-10…+70 °С. Часть микросхем серий К155 и К555 выпускают в керамических корпусах (их обозначение КМ155 и КМ555), температурный диапазон работоспособности таких микросхем -45…+85 °С.

На рис. 1 приведены зависимости выходного напряжения от входного для инвертирующих логических элементов упомянутых серий микросхем при температуре +20 С. Поскольку за порог переключения принимается входное напряжение, при котором выходное равно ему, его нетрудно найти по приведенным зависимостям как точку пересечения с прямой Uвых = Uвх. Из рисунка видно, что микросхемы серии КР1533 имеют наибольший порог переключения — 1,52 В и, как следствие, наибольшую помехоустойчивость.

Рассматриваемые серии имеют в своем составе однотипные микросхемы с совпадающими после номера серии цифробуквенными обозначениями. Логика работы однотипных микросхем, за редким ис-


 

ключением, отмеченным далее, совпадает. Микросхемы серии КР531 ранее не имели в обозначении буквы <Р>, а имели в конце обозначения букву <<П>>, например К531ЛАЗП.

В табл. 2 приведены обозначение большинства рассматриваемых микросхем, функциональное назначение, число выводов корпуса, средняя потребляемая мощность, средняя задержка распространения сигнала и номер рисунка, на котором приведено графическое обозначение микросхемы.

В функциональном назначении буквы означают: OK — микросхемы

имеют выход с открытым коллектором, ОЭ — с открытым эмиттером, Z — выходы могут переводиться в высокоимпедансное состояние.

При разработке принципиальных схем различных устройств всегда возникает вопрос: что делать с- неиспользуемыми входами интегральных микросхем. Если по логике работы на вход необходимо подать лог. 0, то его соединяют с общим проводом, если лог. 1 — возможны варианты. Во-первых, неиспользуемые входы микросхем серии К155 можно никуда не подключать, то есть подпаивать к контактной площадке минимальных размеров, к которой (это важно) не подключены никакие проводники. Но при этом несколько уменьшается быстродействие микросхем. Для микросхем серий К555, КР531, КР1533 оставлять входы неподключенными не допускается. Во-вторых, возможно подключение неиспользуемых входов к используемым входам того же элемента, но это увеличивает нагрузку на микросхему-источник сигнала, что также снижает быстродействие. В-третьих, можно подключать неиспользуемые входы микросхем серий К155 и КР531 к выходу инвертирующего элемента, входы которого при этом надо соединить с общим проводом. Наконец, можно объединять неиспользуемые входы микросхем этих серий и подключать их к источнику питания +5 В через резистор сопротивлением 1 кОм (до 20 входов к одному резистору). Входы микросхем серий К555 и КР1533 можно подключать к источнику питания +5 В непосредственно.

Недопустимо подключать ко входу микросхемы проводник, который во время работы может оказаться неподключенным к выходу источника сигнала, например при управлении от кнопки или переключателя, так как это резко снижает помехоустойчивость устройства. Такие проводники следует подключать к источнику +5 В через резистор сопротивлением 1 кОм (до 20 входов к одному резистору). Входы микросхем серий К555 и КР1533 можно подключать к источнику питания +5 В непосредственно.

На печатных платах с использованием микросхем серий К155, К555, КР1533 необходима установка блокировочных конденсаторов между цепью +5 В и общим проводом. Их число определяется одним-двумя конденсаторами емкостью 0,033…0,15 мкВ на каждые пять микросхем. Конденсаторы следует располагать на плате по возможности равномерно. Их следует также установить рядом со всеми микросхемами с мощным выходом (например, К155ЛА6) или с потребляемой мощностью более 0,5 Вт.

Микросхемы серий КР531 требуют особого внимания при разводке цепей питания и общего провода.


 


 


 


 


 


 


 


 


 


 

  При изготовлении промышленных устройств на микросхемах этой серии используют многослойные печатные платы, один из слоев используют в качестве общего провода, другой — в качестве шины питания. Если используют двухслойные платы, шины питания и общего провода выполняют навесными в виде латунных полос шириной около 5 мм, керамические блокировочные конденсаторы емкостью 0,047…0,15 мкФ подпаивают непосредственно к этим шинам (один конденсатор на одну-две микросхемы). В радиолюбительских условиях можно одну сторону печатной платы использовать под общий провод, другую — под сигнальные цепи и под провод питания, конечно, при этом придется устанавливать много перемычек и к каждой микросхеме блокировочный конденсатор.

Как правило, напряжение питания микросхем подводят к выводу с максимальным номером, общий провод — к выводу, номер которого вдвое меньше. Случаи исключения из этого правила приведены в табл. 3.

Микросхемы серий К555 и КР1533 можно применять вместо однотипных микросхем серии К 155 и совместно с ними, при этом следует иметь в виду, что их нагрузочная способность на микросхемы серии К155 составляет 5. Микросхемы серии КР531 следует применять только в случае необходимости высокого быстродействия, так как они создают большой уровень помех, к которым особенно чувствительны микросхемы серии К555, и потребляют большую мощность.

Цифровые микросхемы по своим функциям делятся на два больших класса — комбинационные и последовательностные. К первому относятся микросхемы, не имеющие внутренней памяти (состояние выходов этих микросхем однозначно определяется уровнями входных сигналов в данный момент времени). Ко второму — микросхемы, состояние выходов которых определяется не только уровнями входных сигналов в данный момент времени, но и последовательностью состояний в предыдущие моменты времени из-за наличия внутренней памяти.

К комбинационным относятся простые логические микросхемы И-НЕ, И-ИЛИ-НЕ, НЕ, ИЛИ-НЕ, И, ИЛИ, более сложные элементы — дешифраторы, мультиплексоры, сумматоры по модулю 2, полные сумматоры, преобразователи кодов для семисегментных и матричных индикаторов, шифраторы, программируемые постоянные запоминающие устройства, преобразователи двоично-десятичного кода в двоичный и обратно, однонаправленные и двунаправленные буферные элементы, мажоритарные клапаны, триггеры Шмитта, которые, однако, имеют внутреннюю память и могут быть отнесены и к последовательностным микросхемам, а также некоторые другие.

К последовательностным микросхемам относятся триггеры, счетчики, сдвигающие регистры, оперативные запоминающие устройства и некоторые другие микросхемы.

Ждущие мультивибраторы нельзя отнести однозначно ни к одному из упомянутых классов, так как внутренняя память этих микросхем помнит изменение входных сигналов ограниченное время, после чего состояние выходов микросхемы ни от чего не зависит. То же самое относится и к генераторным микросхемам.

         

Справочник по цифровым ТТЛ микросхемам. Состав серий и их функциональные аналоги в сериях SN74/SN54

Назначение
Серии
Имя
Аналог SN74/54

Два логических элемента 4И-НЕ 133, К155, 130, К131, 530, К531, 533, К555, 1533, КР1533, КФ1533, 1531, КР1531 ЛА1 20
Логический элемент 8И-НЕ 133, К155, 130, К131, 530, К531, 533, К555, 1533, КР1533, КФ1533 ЛА2 30
Четыре логических элемента 2И-НЕ 133, К155, 130, К131, 530, К531, 533, К555, 1533, КР1533, КФ1533, 1531, КР1531 ЛА3 00
Три логических элемента 3И-НЕ 133, К155, 130, К131, 530, К531, 533, К555, 1533, КР1533, КФ1533, 1531, КР1531 ЛА4 10
Два логических элемента 4И-НЕ с повышенной нагрузочной способностью 133, К155, 130, К131, 533, К555, 1533, КР1533 ЛА6 40
Два логических элемента 4И-НЕ с открытым коллектором 133, К155, 533, К555, К531, 1533, КР1533, КФ1533 ЛА7 22
Четыре логических элемента 2И-НЕ с открытым коллектором 133, К155, 1533, КР1533, КФ1533 ЛА8 01
Четыре логических элемента 2И-НЕ с открытым коллектором 530, К531, 533, К555, 1533, КР1533, КФ1533 ЛА9 03
Три логических элемента 3И-НЕ с открытым коллектором 133, К155, 533, К555, КР1533, КФ1533 ЛА10 12
Четыре логических элемента 2И-НЕ с высоковольтным (до 15 В) открытым коллектором 133, К155, 533, К555 ЛА11 26
Четыре логических элемента 2И-НЕ с мощным выходом (до 48 мА) 133, К155, 530, К531, 533, К555, 1533 ЛА12 37
Четыре логических элемента 2И-НЕ с мощным (до 48 мА) открытым коллектором К155, 533, К555, 530, К531, 1533 ЛА13 38
Элемент сопряжения МОП ЗУ — ТТЛ (4 логических элемента 2И-НЕ) 133 ЛА15 б/а
Два логических элемента 4И-НЕ работающих на 50 Ом (I(0)=60 мА, I(1)= 40 мА) 530, К531 ЛА16 140
Два логических элемента 4И-НЕ работающих на 75 Ом с тремя состояниями 530, К531 ЛА17 б/а
Два логических элемента 2И-НЕ с мощным открытым коллектором К155 ЛА18 75452
Элемент 12И-НЕ с тремя состояниями К531 ЛА19 134
6 мощных логических элемента 2И-НЕ 1530, КР1530 ЛА20 804A
Четыре логических элемента 2И-НЕ КР1533, КФ1533 ЛА21 1000
Два логических элемента 4И-НЕ КР1533, КФ1533 ЛА22 1020
Четыре логических элемента 2И-НЕ с открытым коллектором КР1533, КФ1533 ЛА23 1003
Три логических элемента 3И-НЕ КР1533, КФ1533 ЛА24 1010
Два 4-входовых расширителя по ИЛИ 133, К155, 130, К131 ЛД1 60
8-входовой расширитель по ИЛИ 133, К155 ЛД3 б/а
Четыре логических элемента 2ИЛИ-НЕ 133, К155, 530, К531, 533, К555, 1533, КР1533, КФ1533, 1531, КР1531 ЛЕ1 02
Два логических элемента 4ИЛИ-НЕ со стробированием одного элемента и возможностью расширения по ИЛИ на другом 133, К155 ЛЕ2 23
Два логических элемента 4ИЛИ-НЕ со стробированием 133, К155 ЛЕ3 25
Три логических элемента 3ИЛИ-НЕ К155, 533, К555, КР1533, КФ1533 ЛЕ4 27
Четыре логических элемента 2ИЛИ-НЕ (драйвер линии 75 Ом) I(0)=48 мА, I(1)=2.4 мА 133, K155 ЛЕ5 28
Четыре логических элемента 2ИЛИ-НЕ (драйвер линии 75 Ом) I(0)=48 мА, I(1)=29 мА 133 133ЛЕ6 128
Четыре логических элемента 2ИЛИ-НЕ (драйвер линии 50 Ом) I(0)=48 мА, I(1)=42 мА 155 155ЛЕ6 128
Два логических элемента 5ИЛИ-НЕ К531 ЛЕ7 260
6 мощных логических элемента 2ИЛИ 1530, КР1530 ЛЕ8 805
Четыре логических элемента 2ИЛИ-НЕ КР1533, КФ1533 ЛЕ10 1002
Четыре логических элемента 2ИЛИ-НЕ с открытым коллектором КР1533, КФ1533 ЛЕ11 33
Четыре логических элемента 2И 133, К155, 530, К531, 533, К555, 1533, КР1533, КФ1533, 1531, КР1531 ЛИ1 08
Четыре логических элемента 2И с открытым коллектором 533, К555, 1533, КР1533, КФ1533 ЛИ2 09
Три логических элемента 3И 530, К531, 533, К555, 1533, КР1533, КФ1533, 1531, КР1531 ЛИ3П 11
Три логических элемента 3И с открытым коллектором 533, К555, 1533, КР1533, КФ1533 ЛИ4 15
Два логических элемента 2И с мощным открытым коллектором 133, К155 ЛИ5 75451
Два логических элемента 4И 533, К555, КР1533, КФ1533 ЛИ6 21
6 мощных логических элемента 2И 1530,КР1530 ЛИ7 808
Четыре логических элемента 2И КР1533,КФ1533 ЛИ8 1008
Три логических элемента 3И КР1533,КФ1533 ЛИ10 1011A
Четыре логических элемента 2ИЛИ 133, К155, 530, К531, 533, К555, 1533, КР1533, КФ1533, 1531, КР1531 ЛЛ1 32
Два логических элемента 2ИЛИ с мощным открытым коллектором К155 ЛЛ2 75453
Шесть логических элементов 2ИЛИ 1530, КР1530 ЛЛ3 832
Четыре логических элемента 2ИЛИ 1533, КР1533, КФ1533 ЛЛ4 1032
Шесть мощных (32 мА) драйверов-неинверторов со стробированием 2-х и 4-х линий (3 состояния) К155, 533 ЛЛ11 367
Шесть логических элементов НЕ 133, К155, 130, К131, 530, К531, 533, К555, 1533, КР1533, КФ1533, 1531, КР1531 ЛН1 04
Шесть логических элементов НЕ с открытым коллектором 133, К155, 533, К555, 530, К531, 1533, КР1533, КФ1533 ЛН2 05
Шесть мощных (40 мА) инверторов с высоковольтным открытым коллектором (30 В) 133, К155 ЛН3 06
Шесть мощных (40 мА) инверторов с высоковольтным открытым коллектором (15 В) 133, К155 ЛН5 16
Шесть мощных (32 мА) драйверов-инверторов с общим стробированием выходов и тремя состояниями К155 ЛН6 366
Шесть мощных (32 мА) драйверов-инверторов со стробированием 2-х и 4-х линий (3 состояния) К155, 533, КР1533, КФ1533 ЛН7 368
Шесть мощных инверторов 1533, КР1533, КФ1533 ЛН8 1004
Шесть мощных инверторов с открытым коллектором 1533, КР1533, КФ1533 ЛН10 1005
Мажоритарный элемент с инверсией 533 ЛП3 б/а
Мажоритарный элемент с дополнительным управлением 1533, КР1533, КФ1533 ЛП3 б/а
Шесть мощных (40 мА) неинверторов с высоковольтным открытым коллектором (15 В) К155, КР1533 ЛП4 17
4 логических элемента «исключающее ИЛИ» 133, К155, 533, К555, 530, К531, 1533, КР1533, КФ1533, 1531, КР1531 ЛП5 86
2 логических элемента 2И-НЕ с общим входом и двумя мощными транзисторами 133, К155 ЛП7 75450
4 неинвертора (3 состояния) 133, K155, 533, К555, КР1533, КФ1533 ЛП8 125
Шесть мощных (40 мА) неинверторов с высоковольтным открытым коллектором (30 В) 133, К155 ЛП9 07
Шесть мощных (32 мА) драйверов-неинверторов с общим стробированием выхода (3 состояния) К155 ЛП10 365
Шесть мощных (32 мА) драйверов-неинверторов со стробированием 2-х и 4-х линий (3 состояния) К155, 533 ЛП11 367
4 логических элемента «исключающее ИЛИ» с открытым коллектором 533, К555, КР1533, КФ1533 ЛП12 136
4 логических элемента «исключающее ИЛИ» с открытым коллектором, инверсные 533, К555 ЛП13 266
4 неинвертора (3 состояния) К555 ЛП14 126А
Шесть неинверторов КР1533, КФ1533 ЛП16 1034
Шесть неинверторов с открытым коллектором КР1533, КФ1533 ЛП17 1035
Два логических элемента 2И-2ИЛИ-НЕ, один расширяемый по ИЛИ 133, К155, 130, К131 ЛР1 50
Логический элемент 2-2-2-3И-4ИЛИ-НЕ расширяемый по ИЛИ 133, К155, 130, К131 ЛР3 53
Логический элемент 4-4И-2ИЛИ-НЕ расширяемый по ИЛИ 133, К155, 130, К131, 533, К555, 1533, КР1533, КФ1533 ЛР4 55
Логический элемент 4-2-3-2И-4ИЛИ-НЕ 530, К531, 1531, КР1531 ЛР9 64
Логический элемент 4-2-3-2И-4ИЛИ-НЕ с открытым коллектором 530, К531 ЛР10 65
Логический элемент 4-2-3-2И-4ИЛИ-НЕ 530, К531, 533, К555, 1533, КР1533, КФ1533 ЛР11 51
Логический элемент 2-3-3-2И-4ИЛИ-НЕ 533, К555, 1533, КР1533, КФ1533 ЛР13 54
Два логических элемента 4И-НЕ с триггером Шмитта 133, К155 ТЛ1 13
Шесть логических элементов НЕ с триггером Шмитта 133, К155, 533, К555, КР1533, КФ1533 ТЛ2 14
Четыре логических элемента 2И-НЕ с триггером Шмитта 133, К155, 530, К531 ТЛ3 132

Справочник по микросхемам ТТЛ серий


           СОДЕРЖАНИЕ

От составителя
Номенклатура простой логики
Параметры микросхем простой логики
    Токопотребление
    Задержки
    Дополнительная информация по микросхемам простой логики
    Цоколевка простой логики
Номенклатура СИС

Микросхема
АГ1 — одновибратор
АГ3 — два одновибратора
АГ4 — два одновибратора с триггером Шмитта на входе
АГ5 — два одновибратора с перезапуском
АП2 — четырехразрядный драйвер с открытым коллектором
АП3, АП4, АП5 — два четырехразрядных драйвера с тремя состояниями
АП6 — 8-разрядный двунаправленный шинный транслятор
АП7 — 8-разрядный двунаправленный неинверсный драйвер с открытым коллектором
АП8 — 8-разрядный двунаправленный неинверсный драйвер с тремя состояниями
АП9 — 8-разрядный двунаправленный драйвер с 3 состояниями
АП10 — 8-разрядный двунаправленный приемо-передатчик с регистрами на обоих шинах
АП11 — формирователь импульсов реверсивного счета из квадратурной последовательности импульсов
АП12, АП13 — 8  инверсных(АП12) и неинверсных (АП13) драйверов с 3 состояниями
АП14, АП15 — 8  неинверсных(АП14) и инверсных (АП15) драйверов с 3 состояниями
АП16 — 8 двунаправленных драйверов с 3 состояниями
АП17 — 8-разрядный двунаправленный приемо-передатчик с регистрами на обоих шинах
ВА1 — 4-разрядный двунаправленный приемо-передатчик с лэтчами на обоих шинах
ВЖ1 — 16-разрядная схема контроля по коду Хэмминга
ГГ1 — два генератора, управляемых напряжением
ГГ2 — два генератора, управляемых напряжением
ГГ4 — кварцевый генератор с формирователем кода Джонсона, 4-фазный
ИВ1, ИВ2 — приоритетные кодеры 8 в 3
ИВ3 — приоритетный кодер 10 в 4
ИД1 — высоковольтный дешифратор управления газоразрядным индикатором
ИД3 — демультиплексор 4 в 16
ИД4, ИД5 — сдвоенные демультиплексоры 2 в 4 со стробом
ИД6 — демультиплексор 4 в 10
ИД7 — демультиплексор 3 в 8 со стробом и логикой
ИД8 — дешифратор для неполной матрицы светодиодов 7*5
ИД9 — дешифратор для матрицы светодиодов 7*4
ИД10 — полный дешифратор 2-10 кода в десятичный с открытым коллектором (15 В)
ИД11 — дешифратор 3 в 8 для управления шкалой с заполнением
ИД12 — дешифратор 3 в 8 для управления шкалой со сдвигом точки
ИД13 — дешифратор 3 в 8 для управления шкалой со сдвигом двух точек
ИД14 — 2 демультиплексора со 1 в 4 стробом
ИД15 — дешифратор для управления линейной светоизлучающей шкалой красного цвета
ИД16 — дешифратор для управления линейной светоизлучающей шкалой зеленого или желтого цвета
ИД17 — дешифратор состояний
ИД18 — декодер двоичного кода в семисегментный
ИД22 — дешифратор 4 в 10 с тремя состояниями и изменяемой полярностью выходов
ИД24 — полный дешифратор 2-10 в десятичный с открытым коллектором (30В)
ИЕ1 — декадный счетчик
ИЕ2 — 4-разрядный двоично-десятичный счетчик
ИЕ4 — счетчик-делитель на 12
ИЕ5 — 4-разрядный двоичный счетчик
ИЕ6, ИЕ7 — двоично-десятичный и десятичный счетчики
ИЕ8 — 6-разрядный делитель частоты с переменным коэффициентом деления
ИЕ9 — 4-разрядный десятичный синхронный счетчик
ИЕ10 — 4-разрядный двоичный синхронный счетчик
ИЕ11 — 4-разрядный десятичный синхронный счетчик
ИЕ12, ИЕ13 — двоично-десятичный и десятичный счетчики
ИЕ14, ИЕ15 — двоично-десятичный и десятичный счетчики
ИЕ16, ИЕ17 — двоично-десятичный и десятичный синхронные счетчики
ИЕ18 — 4-разрядный двоичный синхронный счетчик
ИЕ19 — два 4-разрядных двоичных счетчика
ИЕ20 — два 4-разрядных десятичных счетчика
ИЕ21 — 8-разрядный двоичный счетчик с входным регистром и двунаправленной шиной ввода/вывода
ИК1 — схема быстрого умножителя 2*4
ИК2 — АЛУ
ИК4 — 4-разрядный аккумулятор
ИМ1 — одноразрядный полный сумматор
ИМ2 — двухразрядный полный сумматор
ИМ3 — четырехразрядный полный сумматор
ИМ5 — два одноразрядных полных сумматора
ИМ6 — 4-разрядный полный сумматор с ускоренным переносом
ИМ7 — 4 последовательных сумматора/вычитателя
ИП2 — 8-разрядная схема контроля по четности
ИП3 — четырехразрядное АЛУ
ИП4 — схема быстрого переноса для АЛУ
ИП5 — 9-разрядная схема контроля по четности
ИП6, ИП7 — четырехразрядные двунаправленные драйвера
ИП8 — умножитель 2*4
ИП9 — 8-разрядный последовательный умножитель
ИП10 — 12-разрядная схема контроля четности
ИП12 — 4-разрядный двунаправленный приемопередатчик без инверсии и выходом с 3 состояниями
ИП13 — 4-разрядный двунаправленный приемопередатчик с инверсией и выходом с 3 состояниями
ИП14 — четырехразрядное АЛУ
ИП15 — кодек для Ethernet
ИР1 — 4-разрядный универсальный регистр
ИР8 — 8-разрядный сдвигающий регистр со сбросом с параллельным выходом
ИР9 — 8-разрядный сдвигающий регистр с параллельными входами
ИР10 — 8-разрядный сдвигающий регистр со сбросом с параллельной загрузкой и последовательным выходом
ИР11 — 4-разрядный универсальный регистр
ИР12 — 4-разрядный сдвигающий регистр с J-K входами
ИР13 — 8-разрядный универсальный регистр
ИР15 — 4-разрядный параллельный регистр с общим сбросом и выходом с тремя состояниями
ИР16 — 4-разрядный универсальный регистр с тремя состояниями
ИР17 — 12-разрядный регистр последовательного приближения
ИР18, ИР19 — 6 и 4 триггеров с общим тактированием
ИР20 — 4-разрядный параллельный регистр с селектором 2 в 1
ИР21 — 4-разрядный сдвигатель на 0,1,2,3 разряда с тремя состояниями
ИР22 — 8 лэтчей с тремя состояниями
ИР23 — 8 триггеров с тремя состояниями
ИР24 — 8-разрядный универсальный сдвиговый регистр с объединенными входами/выходами
ИР25 — 4-разрядный каскадируемый сдвигающий регистр с 3 состояниями
ИР26 — 4*4 регистровый файл с тремя состояниями
ИР27 — 8-разрядный регистр с разрешением записи
ИР28 — 8-разрядный последовательно-параллельный регистр
ИР29 — 8-разрядный универсальный регистр с тремя состояниями
ИР30 — 8-разрядный адресуемый лэтч
ИР31 — 24-разрядный последовательный регистр сдвига
ИР32 — 4*4 регистровый файл
ИР33, ИР37 — 8 лэтчей (триггеров) с тремя состояниями
ИР34, ИР38 — два 4-разрядных лэтча (триггера) с тремя состояниями и сбросом
ИР35 — 8 D-триггеров с общим тактированием и сбросом
ИР39 — регистр общего назначения с многоканальным доступом
ИР40 — 8-разрядный инверсный лэтч с 3 состояниями
ИР41 — 8-разрядный инверсный регистр с 3 состояниями
ИР42 — 4-разрядный сдвигатель на 0,1,2,3 разряда с тремя состояниями
ИР43 — 8-разрядный регистр
КП1 — Мультиплексор 16 в 1 со стробом и инверсией
КП2 — Сдвоенный мультиплексор 2 в 1 со стробом
КП5, КП7 — мультиплексор 8 в 1 с инверсией (со стробом)
КП11 — 4 мультиплексора 2 в 1 с 3 состояниями
КП12 — Сдвоенный мультиплексор 4 в 1 с 3 состояниями
КП13 — 4 мультиплексора 2 в 1 с памятью (триггер)
КП14 — 4 мультиплексора 2 в 1 с 3 состояниями и инверсией
КП15 — мультиплексор 8 в 1 с 3 состояниями, прямым и инверсным выходами
КП16 — 4 мультиплексора 2 в 1 со стробом
КП17 — сдвоенный инверсный мультиплексор 4 в 1 с 3 состояниями
КП18 — 4 мультиплексора 2 в 1 со стробом и инверсией
КП19 — сдвоенный мультиплексор 4 в 1, инвертирующий
КП20 — 4 мультиплексора 2 в 1 с памятью (триггер)
ПП4 — преобразователь двоичного кода в семисегментный
ПР6 — преобразователь двоично-десятичного кода в двоичный
ПР7 — преобразователь двоичного кода в двоично- десятичный
ПЦ1 — программируемый делитель частоты/таймер
РЕ3 — ППЗУ с однократным программированием 32*8
РЕ4 — ПЗУ-знакогенератор 2К*8
РП1 — 16-битовое регистровое ЗУ (4*4)
РП3 — 16-битовый регистровый файл с 3 состояниями
РУ2, РУ8, РУ9 — ОЗУ на 64 бит с произвольной выборкой
РУ5 — ОЗУ 256*1
РУ7 — ОЗУ 1024*1
РУ10 — FIFO 16*5 бит
РУ11 — ОЗУ 16*4 с 3 состояниями
СП1 — 4-разрядный цифровой компаратор
СП2 — 8-разрядный цифровой компаратор
ТВ1 — J-K триггер с логикой 3И на входе
ТВ6 — два J-K триггера со сбросом
ТВ9-ТВ11 — два J-K триггера
ТВ15 — два J-K триггера
ТМ2 — два D-триггера
ТМ5, ТМ7 — два сдвоенных лэтча
ТМ8, ТМ9 — четыре (шесть) D-триггеров с общим сбросом и тактированием
ТМ10 — четыре D-лэтча с прямыми и инверсными выходами
ТР2 — четыре R-S-триггера
ХЛ1 — многофункциональный элемент для ЭВМ
ХП1 — частотно-фазовый дискриминатор

Соответствие отечественных ТТЛ-микросхем зарубежным аналогам
Соответствие зарубежных ТТЛ-микросхем отечественным аналогам
Состав серий ТТЛ-микросхем
Состав серий ТТЛ-микросхем (продолжение)
Состав серий ТТЛ-микросхем (продолжение)
Состав серий ТТЛ-микросхем (продолжение)
Состав серий ТТЛ-микросхем (продолжение)
Состав серий ТТЛ-микросхем (окончание)

 

ОТ СОСТАВИТЕЛЯ
 

    Вы, наверное, много раз попадали в следующую ситуацию: Вам нужно применить в своей разработке, скажем, 8-разрядный регистр. После долгих поисков Вам удается добыть соответствующие микросхемы и паспорт завода изготовителя к ним. И вот  тут-то Вы обнаруживаете, что из паспорта невозможно определить- регистр ли Вам удалось добыть или же лэтч, с выходом на три состояния он, или со стробированием тактового входа, по какому фронту производится запись в регистр и т.п. Изучив паспорт тщательнее, вы узнаете сколько лет эти микросхемы могут храниться в складских условиях и при какой влажности. В зависимости от фантазии предприятия-изготовителя, в паспорте на микросхему можно найти еще много занимательной информации, но лишь немногие изготовители позволяют себе поместить в паспорт таблицу функций, а некоторые заводы умудряются обойтись всего двумя параметрами: током потребления и какой-то максимальной задержкой.
    Если же Вы попытаетесь воспользоваться одним из справочников государственных издательств, в которых информации содержится как правило несколько больше, чем в паспортах на микросхемы, то в самое неподходящее время (например, после изготовления макета) вы столкнетесь с ошибками, опечатками и другими их недостатками. Поскольку эти справочники в процессе подготовки к печати проходят через массу людей не имеющих никакого отношения к электронике, то ошибки в них являются правилом, а не исключением. Кроме этого, подавляющее большинство справочников устаревает к моменту выхода в печать, а также несут недостаточную информацию о микросхемах.
    Если Вам повезет и Вы сможете добыть ведомственный справочник, то и в этом случае у Вас останется масса проблем- эти тома содержат очень много информации о времени хранения микросхем и условиях такого хранения и в тоже время содержат неполную информацию о микросхемах, вызванную тем простым фактом, что изготовители не заинтересованы в лишней информации о своих изделиях. Кроме этого, информация в ведомственных изданиях появляется часто через несколько лет после начала серийного выпуска микросхемы.
    Если Вы хотите иметь компактный, полный и удобный справочник по широко распространенному семейству стандартных ТТЛ микросхем, то вот то что Вам нужно.
    Этот справочник базируется на том простом факте, что заводы изготовители вынуждены изготавливать ТТЛ микросхемы функционально идентичные соответствующим мировым аналогам, а поэтому все параметры микросхемы, даже не гарантируемые отечественным изготовителем, автоматически оказываются практически идентичными параметрам других изготовителей. Исходя из этого, можно пользоваться справочниками западных изготовителей для тех отечественных микросхем, которые имеют соответствующие  аналоги. Строго говоря, этот справочник и является справочником по зарубежным микросхемам, но адаптированным под соответствующие отечественные аналоги.
    Впервые этот справочник был составлен в начале 80-х годов и с тех пор много лет пополняется. Благодаря хранению справочника в ЭВМ, удавалось избежать появления новых опечаток и исправлять имеющиеся, чему способствовало взаимодействие с коллективом разработчиков радиоэлектронной аппаратуры, использовавших этот справочник все эти годы. Взаимодействие с непосредственными пользователями справочника позволило отработать наиболее удобную форму представления справочных данных, что, как мы надеемся, оцените по достоинству и Вы.
    Для полноты охвата, в справочник включены также и микросхемы не имеющие западного аналога. Для таких ТТЛ-микросхем приведены, естественно, данные из отечественных источников.

    Справочник описывает микросхемы ТТЛ серий 130, 131, 133, 155, 533, 555, 530, 531, 1530, 1531, 1533. Из стандартных ТТЛ серий, в справочник не включены параметры микросхем серий 136/К158 и 134, которые морально устарели, не пополняются новыми разработками и сейчас практически не применяются. Кроме этого в справочник не включены серии 1564 и 1554/КР1554, которые являются совместимыми с ТТЛ-микросхемами стандартных серий, но имеют технологию изготовления КМОП. Эти микросхемы описываются в отдельном справочнике.

    При составлении справочника широко использовались стандартные сокращения и обозначения, распространенные среди западных изготовителей микросхем. Так например, L- означает низкий потенциал (логический нуль при положительной логике), H- высокий потенциал и X- безразлично L или H. Qa=L означает, что соответствующий выход имеет на выходе низкий потенциал.

    Для сокращения объема справочника было использовано два приема.
    1. Параметры простой логики приведены в табличной форме. Это резко сократило объем занимаемого ей места, позволяет легко сопоставлять параметры аналогичных микросхем. Практически вся простая логика различается только логической функцией, цоколевкой, током потребления и задержкой распространения. Входные и выходные характеристики практически для всех микросхем идентичны. Поэтому они приведены для всех микросхем. Для той логики, которая имеет выделенные параметры, они приводятся в отдельной таблице- таблице исключений.
    2. Для сокращения информации в разделе микросхем средней интеграции (СИС), был применен следующий прием- те параметры которые справедливы для большинства СИС (в основном входные и выходные токи и напряжения) приведены в начале раздела и не приводятся в параметрах соответствующей микросхемы.
    Большинство параметров приводятся через одну-две черточки. В первом случае приводятся значения величины минимальное и максимальное. Если присутствуют две черточки, значит приводятся значения минимальное — типовое — максимальное.

    В начале каждого раздела приведена номенклатура микросхем данного раздела, краткая аннотация, список серий в которых она уже присутствует в отечественной литературе, ссылки на цоколевку и страницу с описанием (для СИС). Если здесь присутствует пробел, вопросительный знак или прочерк, это означает что данного параметра нет или он не известен.

    Для того чтобы справочник медленнее старел, в него включались параметры всех семейств, когда в стране осваивалась микросхема хотя бы из одной серии. Благодаря табличной форме представления, эта информация практически не увеличила объема справочника. Если Вас интересует информация о сериях, в которых данная микросхема производится отечественной промышленностью, посмотрите номенклатурный список микросхем в начале раздела.

    Небольшое примечание. Даже западные производители по мере усовершенствования технологии изготовления микросхем пересматривали их параметры и гарантировали более высокие характеристики. Это же относится и к отечественным производителям. Поэтому в справочнике приведены параметры как для западной микросхемы (преимущественно из старых каталогов), так и для отечественной микросхемы (по возможности самые свежие данные). Вы можете сравнить соответствие и, учитывая разницу, можете пользоваться параметрами западных микросхем.

    Справочник составлен в 1991 году, переведен в HTML в 2000 году. 

    Мы надеемся, что Вам понравится наш справочник. 
 

Популярные микросхемы ТТЛ. Серии КР 1533, КР 1531, К 531, К 555, К 155 : [Справочник


Поиск по определенным полям

Чтобы сузить результаты поисковой выдачи, можно уточнить запрос, указав поля, по которым производить поиск. Список полей представлен выше. Например:

author:иванов

Можно искать по нескольким полям одновременно:

author:иванов title:исследование

Логически операторы

По умолчанию используется оператор AND.
Оператор AND означает, что документ должен соответствовать всем элементам в группе:

исследование разработка

author:иванов title:разработка

оператор OR означает, что документ должен соответствовать одному из значений в группе:

исследование OR разработка

author:иванов OR title:разработка

оператор NOT исключает документы, содержащие данный элемент:

исследование NOT разработка

author:иванов NOT title:разработка

Тип поиска

При написании запроса можно указывать способ, по которому фраза будет искаться. Поддерживается четыре метода: поиск с учетом морфологии, без морфологии, поиск префикса, поиск фразы.
По-умолчанию, поиск производится с учетом морфологии.
Для поиска без морфологии, перед словами в фразе достаточно поставить знак «доллар»:

$исследование $развития

Для поиска префикса нужно поставить звездочку после запроса:

исследование*

Для поиска фразы нужно заключить запрос в двойные кавычки:

«исследование и разработка«

Поиск по синонимам

Для включения в результаты поиска синонимов слова нужно поставить решётку «#» перед словом или перед выражением в скобках.
В применении к одному слову для него будет найдено до трёх синонимов.
В применении к выражению в скобках к каждому слову будет добавлен синоним, если он был найден.
Не сочетается с поиском без морфологии, поиском по префиксу или поиском по фразе.

#исследование

Группировка

Для того, чтобы сгруппировать поисковые фразы нужно использовать скобки. Это позволяет управлять булевой логикой запроса.
Например, нужно составить запрос: найти документы у которых автор Иванов или Петров, и заглавие содержит слова исследование или разработка:

author:(иванов OR петров) title:(исследование OR разработка)

Приблизительный поиск слова

Для приблизительного поиска нужно поставить тильду «~» в конце слова из фразы.4 разработка

По умолчанию, уровень равен 1. Допустимые значения — положительное вещественное число.
Поиск в интервале

Для указания интервала, в котором должно находиться значение какого-то поля, следует указать в скобках граничные значения, разделенные оператором TO.
Будет произведена лексикографическая сортировка.

author:[Иванов TO Петров]

Будут возвращены результаты с автором, начиная от Иванова и заканчивая Петровым, Иванов и Петров будут включены в результат.

author:{Иванов TO Петров}

Такой запрос вернёт результаты с автором, начиная от Иванова и заканчивая Петровым, но Иванов и Петров не будут включены в результат.
Для того, чтобы включить значение в интервал, используйте квадратные скобки. Для исключения значения используйте фигурные скобки.

Техническая литература — Интегральные микросхемы ТТЛ, ТТЛШ.

ОГЛАВЛЕНИЕ


Предисловие………………………………………………………………………………………………………………….. 3
Англоязычные сокращения, использованные в справочнике…………………………………………………. 6

Раздел I. Общие сведения об ИС ТТЛ, ТТЛШ
Глава I. Характерные особенности…………………………………………………………………………………….. 9
1.1. Схемотехника…………………………………………………………………………………………………………… 9
1.2. Терминология и обозначение параметров……………………………………………………………………. 15
Глава 2. ИС в узлах радиоэлектронной аппаратуры…………………………………………………………….. 25
2.1. Классификация ИС………………………………………………………………………………………………….. 25
2.2. Система обозначений ИС………………………………………………………………………………………….. 28
2.3. Сопряжение ИС различных серий………………………………………………………………………………. 35

Раздел II. Репрезентативные серии ТТЛ, ТТЛШ
Глава 3. Функциональный состав серий……………………………………………………………………………. 39
3.1. Серия 133 (SN54)…………………………………………………………………………………………………….. 39
3.2. Серия 155 (SN74)…………………………………………………………………………………………………….. 43
3.3. Серия 530 (SN54S)…………………………………………………………………………………………………… 49
3.4. Серия 531 (SN74S)…………………………………………………………………………………………………… 52
3.5. Серия533 (SN54LS)………………………………………………………………………………………………….. 56
3.6. Серия 555 (SN74LS)…………………………………………………………………………………………………. 62
3.7. Серия 1533 (SN54ALS, SN74ALS)………………………………………………………………………………. 68
Глава 4. Комбинационная логика…………………………………………………………………………………….. 76
4.1. Логические элементы НЕ………………………………………………………………………………………….. 76
4.2. Логические элементы И, И-НЕ…………………………………………………………………………………… 78
4.3. Логические элементы ИЛИ, ИЛИ-НЕ………………………………………………………………………….. 86
4.4. Логические элементы И-ИЛИ, И-ИЛИ-НЕ…………………………………………………………………… 90
4.5. Прочие логические элементы и драйверы……………………………………………………………………. 93
4.6. Шифраторы, дешифраторы и демультиплексоры………………………………………………………… 106
4.7. Мультиплексоры……………………………………………………………………………………………………. 125
4.8. Арифметические устройства……………………………………………………………………………………. 135
Глава 5. Последовательная логика………………………………………………………………………………….. 160
5.1. Триггеры………………………………………………………………………………………………………………. 160
5.2. Регистры………………………………………………………………………………………………………………. 170
5.3. Счетчики………………………………………………………………………………………………………………. 190
5.4. Запоминающие устройства………………………………………………………………………………………. 207
Глава 6. Релаксационные устройства………………………………………………………………………………. 212
6.1.0дновибраторы……………………………………………………………………………………………………….. 212
6.2. Мультивибраторы………………………………………………………………………………………………….. 214

Раздел III. Периферийные серии ТТЛ, ТТЛШ
Глава 7. Знакосинтезирующая серия 514…………………………………………………………………………. 217
Глава 8. Интерфейсная серия 559…………………………………………………………………………………… 227
Глава 9. Интерфейсная серия 1102………………………………………………………………………………….. 233
Приложение I. Аналоги ИС фирмы Texas Instruments………………………………………………………… 241
Приложение 2. Указатель ИС, помещенных в справочник…………………………………………………. 247
Список литературы………………………………………………………………………………………………………. 250

Справочник «Цифровые Интегральные Микросхемы»

Каждая серия ИС ТТЛ имеет определенный набор микросхем различного функционального назначения. Совокупность этих микросхем называют функциональным рядом. В различных сериях существуют микросхемы одинакового функционального назначения, имеющие одинаковую структурную схему, условное обозначение и схему подключения (цоколевку). Однако такие микросхемы имеют отличия в технологии изготовления, различные корпуса и существенные отличия в параметрах. Функциональный ряд ИС ТТЛ наиболее распространенных серий приведен в табл. 2.2. Микросхемы указаны в алфавитном порядке их функциональных буквенных обозначений.

Функциональный ряд можно разбить на несколько групп по функциональному назначению: формирователи, генераторы, логические элементы, триггеры, счетчики, ключи и мультиплексоры, регистры, дешифраторы и другие. Рассмотрение таких функциональных групп в справочнике дается от простых групп к сложным, с указанием их условного обозначения, схемы подключения (цоколевки) и основных параметров, сведенных в отдельные таблицы. Такие таблицы основных параметров микросхем, сгруппированных по функциональному назначению, позволяют очень быстро выбрать микросхему с заданными параметрами из всего многообразия серий. Затем в справочнике дается их применение в более сложных устройствах с указанием конкретных серий, номиналов параметров навесных элементов и отдельных вариантов практических схем.

Микросхемы памяти и схемы вычислительных средств в данном справочнике не рассматриваются ввиду их специфического назначения и наличия специальных справочников, например [3].

Таблица 2.2. Функциональный ряд основных серий микросхем ТТЛ
Назначение, функциональные возможности Тип133, Н133, КМ133 134, К134, КР134 155, К155, КМ155 199 530, М530, Н530, КМ530 К531, КМ531, КР531 533, Н533 555, К555, КМ555 К599 КР1531 1533, КР1533
Одновибратор АГ1 + + +
Два одновибратора АГ3 + +> + + +
Два одновибратора АГ4 +
Сдвоенный формирователь АП2 + +
Двухканальный восьмиразрядный инвертирующий формирователь АП3 + + + + +
Двухканальный восьмиразрядный формирователь АП4 + + + + +
Восьмиканальный однонаправленный формирователь АП5 + + +
Восьмиканальный двунаправленный формирователь АП6 + + +
Восьмиканальный однонаправленный формирователь АП14 +
Восьмиканальный однонаправленный формирователь АП16 +
Двойной управляемый генератор ГГ1 + +
Приоритетный шифратор 8-3 ИВ1 + + + +
Приоритетный шифратор 10-4 ИВ3 +
Двоично-десятичный дешифратор высоковольтный ИД1 + +
Дешифратор-демультиплексор 4*16 ИД3 + + + + +
Сдвоенный дешифрагор-мультиплексор 2×4 ИД4 + + + + +
Cдвоенный дешифратор-мультиплексор 2х4 с открытым коллектором ИД5 + +
Двоично-десятичный дешифратор 4*10 ИД6 + + +
Двоичный дешифратор ИД7 + + + + +
Назначение, функциональные возможности Тип133, Н133, КМ133 134, К134, КР134 155, К155, КМ155 199 530, М530, Н530, КМ530 К531, КМ531, КР531 533, Н533 555, К555, КМ555 К599 КР1531 1533, КР1533
Дешифратор для управления матрицей на светодиодах ИД8 +
ИД9 +
Двоично-десятичный дешифратор ИД10 + +> + +
Дешифратор 3*8:
а) с запоминанием
б) со сдвигом 1 точки
в) со сдвигом 2 точек
ИД11 +
ИД12 +
ИД13 +
Два дешифратора-демультиплексора 2*4 ИД14 + +
Дешифратор для управления шкалой красного цвета ИД15 + +
Дешифратор для управления шкалой зеленого или желтого цвета ИД16 +
Дешифратор состоянийИД17+
Дешифратор двоично-десятичного кода в информацию для семисегментного индикатора ИД18 +
Дешифратор-демультиплексор 4х16 ИД19 +
Декадный счетчик ИЕ1 +
Четырехразрядный двоично-десятичный счетчик ИЕ2 + + + +
Счетчик-делитель ИЕ4 + +
Двоичный счетчик ИЕ5 + + + + +
Двоично-десятичный реверсивный счетчик ИЕ6 + + + + +
Назначение, функциональные возможности Тип133, Н133, КМ133 134, К134, КР134 155, К155, КМ155 199 530, М530, Н530, КМ530 К531, КМ531, КР531 533, Н533 555, К555, КМ555 К599 КР1531 1533, КР1533
Четырехразрядный двоичный реверсивный счетчик ИЕ7 + + + + +
Делитель частоты с переменным коэффициентом деления ИЕ8 + +
Четырехразрядный десятичный синхронный счетчик ИЕ9 + + + +
Четырехразрядный двоичный синхронный счетчик ИЕ10 + + + +
Четырехразрядный двоичный синхронный счетчик ИЕ11 +
Четырехразрядный двоичный синхронный счетчик ИЕ13 +
Двоично-десятичный счетчик ИЕ14 + + + + +
Двоичный счетчик асинхронный ИЕ15 + + + +
Четырехразрядный десятичный реверсивный счетчик ИЕ16 + +
Четырехразрядный двоичный реверсивный счетчик ИЕ17 + +
Четырехразрядный двоичный синхронный счетчик ИЕ18 + +
Два четырехразрядных счетчика ИЕ19 +
Назначение, функциональные возможности Тип133, Н133, КМ133 134, К134, КР134 155, К155, КМ155 199 530, М530, Н530, КМ530 К531, КМ531, КР531 533, Н533 555, К555, КМ555 К599 КР1531 1533, КР1533
Схема быстрого умножителя 2*4 разряда ИК1 + +
Арифметическо-логическое устройство с умножением ИК2 +
Одноразрядный полный сумматор ИМ1 + +
Двухразрядный полный сумматор ИМ2 + +
Четырехразрядный двоичный сумматор ИМ3 + +
Четырехразрядный полный сумматор ИМ4 +
Два одноразрядных двоичных полных сумматора ИМ5 + + +
Четырехразрядный двоичный сумматор с ускоренным переносом ИМ6 + +
Четырехразрядный сумматор-вычитатель ИМ7 + +
8-разрядная схема контроля четности и нечетности ИП2 + + +
АЛУ для записи двух 4-разрядных слов ИП3 + + + + + + + +
Схема ускоренного переноса для АЛУ ИП4 + + + + + + + +
9-разрядная схема контроля четности ИП5 + + + + +
4-шинный приемопередатчик с инверсными выходами ИП6 + + +
4-шинный приемопередатчик ИП7 + + +
8-разрядный последовательно-параллельный двоичный перемножитель ИП9 +
Продолжение табл. 2.2.
Назначение, функциональные возможности Тип133, Н133, КМ133 134, К134, КР134 155, К155, КМ155 199 530, М530, Н530, КМ530 К531, КМ531, КР531 533, Н533 555, К555, КМ555 К599 КР1531 1533, КР1533
4-разрядный универсальный сдвиговый регистр ИР1 + + +
8-разрядный сдвигающий регистр ИР2 +
4-разрядный селективный накопительный регистр ИР5 +
8-разрядный последовательный сдвигающий регистр с параллельным выходом ИР8 + + +
8-разрядный сдвиговый регистр с параллельным вводом информации ИР9 + +
8-разрядный сдвиговый регистр ИР10 +
4-разрядный универсальный регистр сдвига ИР11 + + + +
4-разрядный сдвиговый регистр с параллельным вводом информации ИР12 + +
8-разрядный реверсивный сдвиговый регистр ИР13 + +
4-разрядный регистр ИР15 + +
4-разрядный универсальный регистр сдвига ИР16 + +
12-разрядный регистр последовательного приближения ИР17 + +
6-разрядный параллельный регистр с D-триггерами ИР18 + +
4-разрядный параллельный регистр с D-триггерами ИР19 + +
4-разрядный двухвходовый регистр ИР20 + +
4-разрядное сдвигающее устройство ИР21 + +
Назначение, функциональные возможности Тип133, Н133, КМ133 134, К134, КР134 155, К155, КМ155 199 530, М530, Н530, КМ530 К531, КМ531, КР531 533, Н533 555, К555, КМ555 К599 КР1531 1533, КР1533
8-разрядный регистр на D-триггерах с потенциальным входом ИР22 + + + + +
8-разрядный регистр на D-триггерах с динамическим входом ИР23 + + + + +
8-разрядный универсальный сдвиговый регистр ИР24 + +
4-разрядный регистр с импульсным управлением ИР25 +
Регистровый файл 4 слова на 4 разряда ИР26 + +
8-разрядный регистр ИР27 + +
8-разрядный последовательно-параллельный регистр ИР28 +
8-разрядный регистр хранения с адресацией ИР30 +
24-разрядный последовательный регистр сдвига ИР31 +
Регистровый файл 4 слова на 4 разряда с открытым коллекторным выходом ИР32 + +
8-разрядный буферный регистр ИР33 +
Два 4-разрядных буферных регистра ИР34 +
8-разрядный буферный регистр с импульсным управлением ИР37 +
Два 4-разрядных регистра D-типа ИР38 +
БИС регистров общего назначения с многоканальным доступом ИР39 +
Назначение, функциональные возможности Тип133, Н133, КМ133 134, К134, КР134 155, К155, КМ155 199 530, М530, Н530, КМ530 К531, КМ531, КР531 533, Н533 555, К555, КМ555 К599 КР1531 1533, КР1533
Селектор-мультиплексор на 16 каналов со стробированием КП1 + +
Сдвоенный цифровой селектор-мультиплексор 4-1 КП2 + + + + + + +
Селектор-мультиплексор на 8 каналов КП5 + +
Селектор-мультиплексор на 8 каналов со стробированием КП7 + + + + + + +
Три схемы переключателя КП8 +
Сдвоенный коммутатор 4 каналов в 1 КП9 +
Коммутатор 8 каналов в 1 КП10 +
4-разрядный селектор-мультиплексор 2 в 1 с тремя состояниями КП11 + + + + +
2-разрядный 4-канальный коммутатор КП12 + + + +
Четыре 2-входовых мультиплексора с запоминанием КП13 + + +
4-разрядный селектор-мультиплексор 2 каналов в 1 с инверсией и тремя состояниями КП14 + + + + +
8-входовый селектор-мультиплексор КП15 + + + + +
4-разрядный селектор-мультиплексор 2 каналов в 1 КП16 + + + +
Сдвоенный инверсный селектор- мультиплексор 4 каналов в 1 с тремя состояниями КП17 +
4-разрядный селектор- мультиплексор 2 каналов в 1 с инверсными выходами КП18 + +
Сдвоенный селектор-мультиплексор 4 каналов в 1 КП19 +
Назначение, функциональные возможности Тип133, Н133, КМ133 134, К134, КР134 155, К155, КМ155 199 530, М530, Н530, КМ530 К531, КМ531, КР531 533, Н533 555, К555, КМ555 К599 КР1531 1533, КР1533
Два логических элемента 4И-НЕ ЛА1 + + + + + + + +
Логический элемент 8И-НЕ ЛА2 + + + + + + + +
Четыре логических элемента 2И-НЕ ЛАЗ + + + + + + + +
Три логических элемента 3И-НЕ ЛА4 + + + + + + + +
Два логических элемента 4И-НЕ с повышенной нагрузочной способностью ЛА6 + + + +
Два логических элемента 4И-НЕ с открытым коллекторным выходом ЛА7 + + + + + +
Четыре логических элемента 2И-НЕ с открытым коллекторным выходом ЛА8 + + + +
Четыре логических элемента 2И-НЕ с открытым коллекторным выходом ЛА9 + + + + +
Три логических элемента 3И-НЕ с открытым коллекторным выходом ЛА10 + + + +
Четыре логических элемента 2И-НЕ с открытым коллекторным выходом, высоковольтных ЛА11 + +
Четыре логических элемента 2И-НЕ с высокой нагрузочной способностью ЛА12 + + + + + +
Четыре логических элемента 2И-НЕ с открытым коллектором и высокой нагрузочной способностью ЛА13 + + + +
Четыре логических элемента 2И-НЕ сопряжения микросхем МОП ЗУ-ТТЛ ЛА15 +
Два логических элемента 4И-НЕ (магистральный усилитель) ЛА16 + +
Два логических элемента 4И-НЕ с тремя состояниями на выходе ЛА17 + +
Два логических элемента 2И-НЕ с мощным открытым коллекторным выходом ЛА18 +
Логический элемент 12И-НЕ с тремя состояниями на выходе ЛА19 +
Назначение, функциональные возможности Тип133, Н133, КМ133 134, К134, КР134 155, К155, КМ155 199 530, М530, Н530, КМ530 К531, КМ531, КР531 533, Н533 555, К555, КМ555 К599 КР1531 1533, КР1533
Четыре логических элемента 2И-НЕ/2ИЛИ-НЕ ЛБ1 +
Два логических элемента 4 И-НЕ/4 ИЛИ-НЕ и логический элемент НЕ ЛБ2 +
Два 4-входовых логических расширителя по ИЛИ ЛД1 + + +
8-входовый расширитель по ИЛИ ЛД3 + +
Четыре логических элемента 2 ИЛИ-НЕ ЛЕ1 + + + + + + + +
Два 4-входовых логических элемента ИЛИ-НЕ со стробированием на одном и расширением по ИЛИ на другом ЛЕ2 +
Два логических элемента 4 ИЛИ-НЕ со стробированием ЛЕ3 + +
Три логических элемента 3 ИЛИ-НЕ ЛЕ4 + + +
Четыре логических элемента 2 ИЛИ-НЕ буферных ЛЕ5 + +
Четыре логических элемента 2 ИЛИ-НЕ, магистральный усилитель ЛЕ6 + +
Два логических элемента 5 ИЛИ-НЕ ЛЕ7 +
Четыре логических элемента 2И ЛИ1 + + + + + + + + +
Четыре логических элемента 2И с открытым коллекторным выходом ЛИ2 + +
Три логических элемента 3И ЛИ3 + + + + +
Три логических элемента 3И с открытым коллекторным выходом ЛИ4 +
Два логических элемента 2И с мощным открытым коллекторным выходом ЛИ5 + +
Два логических элемента 4И ЛИ6 + +
Назначение, функциональные возможности Тип133, Н133, КМ133 134, К134, КР134 155, К155, КМ155 199 530, М530, Н530, КМ530 К531, КМ531, КР531 533, Н533 555, К555, КМ555 К599 КР1531 1533, КР1533
Логический элемент 4И- 2ИЛИ- НЕ/4 И-2 ИЛИ с возможностью расши рения по ИЛИ ЛК1 + +
Два логических элемента 2 (2- 2И- 2ИЛИ- НЕ / 2- 2И- 2ИЛИ) ЛК3 + +
Логический элемент 2- 2- 2- 2И- 4ИЛИ- НЕ / 2- 2- 2- 2И- 4ИЛИ с возможностью расширения по ИЛИ ЛК4
Логический элемент 8H-НЕ/8И с возможностью расширения по ИЛИ ЛК5 + +
Два логических элемента 2И- 2И- 2ИЛИ / 2И- 2И- 2ИЛИ- НЕ ЛК6 + +
Логический элемент 2И- 2И- 2И- 2И- 4ИЛИ / 2И- 2И- 2И- 2И- 4ИЛИ- НЕ с возможностью расширения по ИЛИ ЛК7 +
Четыре логических элемента 2ИЛИ ЛЛ1 + + + + + + +
Два логических элемента 2ИЛИ с мощным открытым коллекторным выходом ЛЛ2 +
Шесть логических элементов НЕ ЛН1 + + + + + + + +
Шесть логических элементов НЕ с открытым коллекторным выходом ЛН2 + + + + + + +
Шесть буферных логических элементов НЕ с повышенным коллекторным напряжением ЛНЗ + +
6 элементов НЕ с открытым коллектором ЛН4
Шесть буферных логических элементов НЕ ЛН5 + +
Шесть логических элементов НЕ с тремя состояниями на выходе ЛН6 +
Назначение, функциональные возможности Тип133, Н133, КМ133 134, К134, КР134 155, К155, КМ155 199 530, М530, Н530, КМ530 К531, КМ531, КР531 533, Н533 555, К555, КМ555 К599 КР1531 1533, КР1533
Два приемника сигналов с парафазным входом и выходом ЛП1 +
Три логических элемента мажоритарной логики 2-2-2-И-3 ИЛИ-НЕ ЛП3 + + +
Шесть буферных формирователей с открытым коллектором ЛП4 +
Четыре 2-входовых элемента «исключающее ИЛИ» ЛП5 + + + + + + +
Два логических элемента 2И-НЕ с общим входом и двумя мощными транзисторами ЛП7 + +
Четыре буферных элемента с тремя состояниями на выходе ЛП8 + + + +
Шесть буферных формирователей с открытым коллектором и повышен ным коллекторным напряжением ЛП9 + +
Шесть повторителей с элементом управления по входам и тремя со стояниями на выходе ЛП10 +
Шесть повторителей с раздельными элементами управления входами по двум и четырем повторителям с тремя состояниями на выходе ЛП11 +
Четыре 2-входовых логических элемента «исключающее ИЛИ» с от крытым коллекторным выходом ЛП12 +
Назначение, функциональные возможности Тип133, Н133, КМ133 134, К134, КР134 155, К155, КМ155 199 530, М530, Н530, КМ530 К531, КМ531, КР531 533, Н533 555, К555, КМ555 К599 КР1531 1533, КР1533
Два логических элемента 2-2И-2ИЛИ-НЕ, один расширяемый по ИЛИ ЛР1 + + +
Логический элемент 2И-2И-3И-4ИЛИ-НЕ ЛР2 +
Логический элемент 2-2-2-3И-4ИЛИ-НЕ с возможностью расширения по ИЛИ ЛР3 + +
Логический элемент 4И-2ИЛИ-НЕ с возможностью расширения по ИЛИ ЛР4 + + + + + +
Логический элемент 4-2-2-3И-4ИЛИ-НЕ ЛР9 + +
Логический элемент 4-2-2-3И-4ИЛИ-НЕ с открытым коллекторным выходом ЛР10 +
Два логических элемента 2-2(3-3)И-2ИЛИ-НЕ ЛР11 + + + + +
Логический элемент (2-3-3-2)И-4ИЛИ-НЕ ЛР13 + + +
Преобразователь двоично-десятичного кода в двоичный ПР6 +
Преобразователь двоичного кода в двоично-десятичный ПР7 +
Схема сравнения двух 4-разрядных чисел СП1 + + + + + +
JК — триггер с логикой ЗИ на входе ТВ1 + + +
Два JK-триггера со сбросом ТВ6 + +
Два JK-триггера с установкой «О» и «1» ТВ9 + + + +
Два JK-триггера с установкой «1» ТВ10 + +
Два JK-триггера с раздельной установкой «1» и общими установкой нуля и синхронизацией ТВ11 + +
Два JK-триггера ТВ14 +
Два JK-триггера ТВ15 + + +
Два триггера Шмитта с логическим элементом на входе 4И-НЕ ТЛ1 + +
Шесть триггеров Шмитта ТЛ2 + + + +
Четыре 2-входовых триггера Шмитта ТЛ3 + + + +
Два D-триггера ТМ2 + + + + + + + +
Четыре D-триггера ТМ5 + +
Четыре D-триггера с прямыми и инверсными выходами ТМ7 + + + +
Четыре синхронных D-триггера ТМ8 + + + + + +
Шесть синхронных D-триггеров ТМ9 + + + + +
Четыре RS-триггера ТР2 + + +
Многофункциональный элемент для ЭВМ ХЛ1 + +

мир электроники — Микросхемы серии К155

электронные компоненты

 материалы в категории

Микросхемы серии К155 (К555, К1533, К133) это простые логические элементы выполненные по технологии ТТЛ.

Предельно допустимые режимы эксплуатации

1 Напряжение питания 4,75…5,25 В
2 Входное напряжение низкого уровня  0,4 В
3 Входное напряжение высокого уровня  2,4 В
4 Входной ток низкого уровня
  для К155ЛЕ5,КМ155ЛЕ5,К155ЛЕ6,КМ155ЛЕ6
 16 мА
 48 мА
5 Выходной ток высокого уровня
  для К155ЛЕ6,КМ155ЛЕ6 при Uон=2 В
 -0,8 мА
 -42,4 мА
6 Ток нагрузки для К155РУ5  20 мА
7 Емкость нагрузки  15 пФ
8 Длительность фронта и среза входного импульса  150 нс
9 Температура окружаюшей среды:
  К155
  КМ155
  
-10…+70 ° C 
-45…+85 ° C

Общие рекомендации по применению

Температура пайки 235  5 ° С, продолжительность пайки (2  0,5) c, расстояние от нижней плоскости корпуса до места пайки не менее 1 мм. Температура пайки при автоматизированной сборке не более 265 ° С, продолжительность пайки не более 4 с.Допустимое значение статическоо потенциала 200 В. Не рекомендуется полведение каких-либо электрических сигналов (в том числе шин «питание» и «корпус») к неиспользуемым выводам микросхем.При ремонте аппаратуры замену микросхем необходимо производить при отключенных источниках питания.Допускается напряжение на входе микросхемы не менее — 0,4 В и напряжение на выходе не менее — 0,3 В. Свободные входы микросхем, не используемые согласно электрической схеме аппаратуры, должны быть подключены к источнику питания 5 В  10 % через резистор с сопротивлением 1 кОм. Одновременно подключается 20 входов. Для случайных помеховых сигналов, превышающих по амплитуде нормы ТУ, для случайных кратковременных нарушений стабилизации питающих напряжений допускается кратковременное воздействие напряжения питания 7 В.

Цоколевка микросхем серии К155

 

5962-01-413-1533 — МИКРОСХЕМА ПАМЯТИ, 12931081, 01-413-1533, 014131533

×

Группа 85: Электрические машины, оборудование и их части; Звукозаписывающие и воспроизводящие устройства, устройства для записи и воспроизведения телевизионного изображения и звука, а также их части и принадлежности

Номер приложения Б и заголовки Описание товара Кол-во единиц
85.42 — Электронные интегральные схемы; их части:
— — Электронные интегральные схемы:
8542.31.0000 — — — Процессоры и контроллеры, совмещенные или не совмещенные с запоминающими устройствами, преобразователями, логическими схемами , усилители, тактовые и временные схемы или другие схемы No.
8542.32 — — — Воспоминания:
— — — — Динамический произвольный доступ для чтения и записи:
8542.32.0015 — — — — — Не более 1 гигабита No.
8542.32.0023 — — — — — Более 1 гигабита No.
8542.32.0040 — — — — Статическое чтение-запись с произвольным доступом (SRAM) No.
8542.32.0050 — — — — Электрически стираемая программируемая постоянная память (EEPROM) No.
8542.32.0060 — — — — Стираемая (кроме электрически) программируемая постоянная память (EPROM)
8542. 32.0070 — — — — Другое
8542.33.0000 — — — Усилители
8542.39.0000 — — — Другое
8542.90.0000 — — — Детали X
Модуляция делительного усиления

обеспечивает гибкое и быстрое вовлечение в неокортикальную микросхему. Модель

Неокортикальная микросхема.

Модель, используемая в этом исследовании, является расширенной версией пространственно локализованной модели Уилсона – Коуэна (Wilson and Cowan, 1972). Эта модель неокортикальной микросхемы включает одну возбуждающую популяцию, E , и две ингибирующие субпопуляции: одну нацеленную на дендриты, I dend и одну нацеленную на сому межнейронную популяцию, I soma (см.рис. 1 А ). Две ингибирующие субпопуляции различаются типом ингибирующей модуляции, которую они обеспечивают возбуждающей популяции. I dend всегда обеспечивает субтрактивное подавление, то есть субтрактивную модуляцию функции ввода-вывода своей цели: сдвиг кривой в сторону более высоких входных значений. I soma может обеспечить комбинацию вычитающего и разделяющего ингибирования, то есть модуляции разделяющего усиления, на возбуждающую популяцию: уменьшая наклон и максимальный выходной сигнал функции (см. Схемы модуляции на рис. 1 A ) .

Фиг.1. Модель неокортикальной микросхемы и меры увлечения. A : схематическая модель цепи неокортекса. Он включает одну возбуждающую ( E ) и две ингибирующие субпопуляции, одну нацеленную на дендриты ( I dend ) и одну межнейронную популяцию, нацеленную на сому ( I сома ), и веса ( w ). их связей. Обратите внимание, что характер подавления, доставляемого от I сома до E , определяется параметром делимости 0 ≤ q ≤ 1 (показано синим).Он варьируется от полностью вычитающей ( q = 0) до полностью разделяющей ( q = 1) модуляции. Также показаны схемы этих двух типов модуляции ввода-вывода. B : пример захвата. Первоначально схема получает постоянный входной сигнал, P ( t ) = P , и колеблется на своей собственной частоте, f [представленная активностью возбуждающего населения E ( t )]. Входной сигнал становится синусоидальной волной с амплитудой Λ и входной частотой f в .Микросхема успешно увлекается входной частотой. C : увлечение микросхемы может занять несколько циклов колебаний, как показано в этом примере. Время сходимости рассчитывается как время, необходимое для схождения активности до последнего предельного цикла. Затем рассчитывается индекс увлечения из спектра мощности сигнала E ( t ) после его схождения.

В исходной модели Уилсона – Коуэна используется субтрактивная модуляция, но, чтобы ввести в модель делительную модуляцию, нам нужно определить сигмоидальную функцию ввода-вывода, которая принимает три переменные: вход или привод, x ; субтрактивная модуляция,; и делительная модуляция, A:

Fe, ix, Θ, Α = αe, iαe, i + qΑ11 + exp − αe, ix − θe, i + Θ + 1 − qΑ − 11 + expαe, iθe, i, ( 1)

, где e обозначает возбуждающий, а i обозначает тормозной.Функция определена со всеми входными данными, которые являются действительными неотрицательными значениями. Константа θ e, i — это минимальное смещение функции ввода-вывода по оси x для соответствующей совокупности, представляющее состояние по умолчанию, когда нет вычитающего запрета, который смещает функцию дальше. Константа α e, i — это максимальное усиление сигмоидальной функции для соответствующей совокупности, представляющее состояние по умолчанию, когда нет разделяющего запрета, уменьшающего усиление функции.Обратите внимание, как параметр делимости q ∈ [0, 1] управляет эффектом делительной модуляции A. Только тогда, когда q = 1, модуляция является чисто разделительной. Более низкое значение приводит к комбинации вычитающей и делительной модуляции, и она становится чисто вычитающей с q = 0. Кроме того, обратите внимание, что когда A = 0, эта функция эквивалентна сигмоидальной функции, используемой в исходной модели Уилсона – Коуэна. модель (Уилсон и Коуэн, 1972). Определенная здесь функция ввода-вывода является разновидностью функции, используемой в Papasavvas et al.(2015), и мы объяснили его точный вывод в Papasavvas and Wang (2019).

С помощью функции ввода-вывода F e, i микросхема неокортекса описывается следующей системой обыкновенных дифференциальных уравнений:

τdEtdt = −Et + ke − EtFew1Et + Pt, w2Idendt, w3Isomat,

τdIdendtdt = −Idendt + ki − IdendtFiw4Et, 0,0,

τdIsomatdt = −Isomat + ki − IsomatFiw5Et, w6Idendt + w7Isomat, 0, (2)

где, аналог исходной модели Уилсона – Коуэна, limx → ∞Fe, ix, 0,0 = expαe, iθe, i1 + expαe, iθe, i.(3)

Рис. 1 A показывает схему неокортикальной микросхемы с указанием возбуждающих и тормозных связей и их веса, w . Чтобы ограничить параметры этой модели, мы использовали данные, полученные в первичной зрительной коре Pfeffer et al. (2013). Во-первых, I dend подавляет I soma , но не взаимно. Во-вторых, существует самоторможение для I soma , но не для I dend .В-третьих, некоторые значения веса устанавливаются относительно w 3 : w 7 = w 3 , w 2 = 0,54 w 3 и w 6 = 0,33 w 3 .

Параметры, используемые для функций ввода-вывода F e, i ( уравнение 1 ): θ e = 4, θ i = 3,7, α e = 1.3 и α i = 2. Это значения, использованные в исходной модели Уилсона – Коуэна (Wilson and Cowan, 1972). Постоянная времени была установлена ​​на τ = 0,05. Это значение было выбрано на основе реакции модели неокортикальной микросхемы на мгновенный ввод (см. Дополнительный рисунок S1; см. Https://doi.org/dkwh), который имеет характерный период полураспада t 1 / 2 = 39,8 мс, что приблизительно соответствует отклику электрически стимулированных микросхем неокортекса в электрофизиологических экспериментах (Alfonsa et al.2015).

Модель микросхемы была специально разработана для исследования влияния разделяющего ингибирования, которое доставляется популяцией ингибиторов нацеливания на сому I сома , на захват микросхемы. Параметр деления q включен в модель для создания континуума между двумя крайностями: от чисто субтрактивного ингибирования до чисто разделяющего ингибирования, обеспечиваемого I сома . Изменяя параметр q от 0 до 1, мы можем количественно исследовать, используя соответствующие меры (см. Ниже), как на увлечение влияет систематическое увеличение разделяющей способности тормозящей модуляции.Обратите внимание, что параметр деления управляет только модуляцией, подаваемой I soma на E , в то время как I dend всегда обеспечивает чисто субтрактивную модуляцию, и это связано с тем, что модуляция делительного усиления была связана с нацеливанием на сомы. интернейроны в неокортексе (Atallah et al. (2012); Pouille et al. (2009); Wilson et al. (2012); однако см. также Seybold et al. (2015)). Несмотря на то, что разделение обеспечивается исключительно за счет I soma , мы по-прежнему включаем I dend в модель, чтобы можно было сравнить с предыдущими результатами моделирования.

Модели нейронной массы могут работать во многих различных режимах, даже при постоянном вводе. Систематический анализ их динамики показал, что они могут находиться в (устойчивом) стабильном состоянии, либо в устойчивой фиксированной точке, либо в стабильном предельном цикле (Grimbert and Faugeras 2006; Spiegler et al. 2010; Wilson and Cowan 1972). Они также могут находиться в предельно стабильной фиксированной точке, то есть в критической точке между поглощающим состоянием и активированным состоянием, что отражает свидетельство критичности экспериментальных данных (Cowan et al.2016). Даже хаотические режимы могут быть достигнуты в модели нейронной массы как минимум с тремя переменными (Papasavvas et al. 2015; Spiegler et al. 2011). Однако в этом исследовании, как и в предыдущей работе (Spiegler et al. 2011), мы исследуем явление увлечения только в режиме стабильного предельного цикла, то есть при существующем колебании перед любым колебательным движением. Это связано с тем, что эффект увлечения в биологическом смысле обычно рассматривается как управляемая вводом адаптация уже существующего колебания.

Выборка пространства параметров и поиск локальных оптимумов.

Чтобы исследовать влияние параметра делимости q на развлекательные показатели, мы должны были установить такие параметры микросхемы, чтобы ее собственная колебательная активность [ответ на постоянный входной сигнал P ( t ) = P ] при q = 0 и q = 1 сопоставимы. Мы разработали стратегию выборки пространства параметров для параметров { P , w 1 , w 3 , w 4 , w 5 } и создания коллекции допустимых наборов параметров.Другие параметры подключения { w 2 , w 6 , w 7 } устанавливаются относительно w 3 (см. Выше). Чтобы набор параметров считался допустимым для исследования, он должен соответствовать следующим условиям:

  1. Он следует отношениям связи, полученным из Pfeffer et al. (2013).

  2. Он вызывает колебательное поведение как для q = 0, так и для q = 1 с постоянным входом, P ( t ) = P .

  3. Разница между размахом размаха (см. Рис. 1) для E ( t ) при q = 0 и q = 1 меньше 0,001.

  4. Размах амплитуды I сома ( t ) по крайней мере такой же большой, как размах амплитуды E ( t ) на обоих q = 0 и q = 1.

Обратите внимание, что необходимо применить ограничение на амплитуду I сома ( t ) ( условие 4 ), поскольку существует возможность подключения параметры, уменьшающие амплитуду I сома ( t ) при сохранении колебаний в двух других популяциях.В этом случае система сводится к классической двумерной системе E I (Wilson, Cowan, 1972). Аналогичное ограничение для I dend ( t ) не является необходимым, потому что устойчивые колебания в микросхеме невозможны при пониженной активности в I dend ( t ) при q = 1. . Чтобы создать набор таких наборов параметров, мы случайным образом выбрали гиперкуб в пространстве параметров, определяемом интервалами: P ∈ [0, 5] и w k ∈ [0, 35] для k ∈ {1, 3, 4, 5}.После того, как мы сгенерировали остальные параметры на основе условия 1 , система была смоделирована, и были сохранены только те образцы, которые соответствовали условию 2 . Эти наборы затем использовались в качестве отправных точек для задачи оптимизации. Задача оптимизации заключалась в том, чтобы минимизировать разницу между размахом амплитуд E ( t ) при q = 0 и q = 1 ( условие 3 ) при сохранении размаха до пиковая амплитуда I сома ( t ), по крайней мере, такая же большая, как размах амплитуды E ( t ) ( условие 4 ).Во время оптимизации использовался штрафной член, чтобы гарантировать, что условие 4 выполняется и что параметры не отклоняются от гиперкуба, определенного выше. Задача оптимизации решалась с помощью решателя нелинейного программирования fminsearch в MATLAB.

Действительный набор параметров был первоначально создан с помощью этого метода и использован в качестве примера набора для результатов на рис. 2 и 3. Набор примеров: { P = 1,428, w 1 = 24,368, w 3 = 9.677, w 4 = 27,249, w 5 = 30,913}. Другие параметры подключения устанавливаются относительно w 3 , то есть w 2 = 5,225, w 6 = 3,193 и w 7 = 9,677.

С целью обобщения результатов по разным областям пространства параметров мы создали коллекцию допустимых наборов после обширной выборки. Случайная выборка из 250 000 наборов параметров сгенерировала набор из 1227 наборов параметров, которые соответствуют условиям 1 и 2 .Из этих наборов 981 считался уникальным с допуском 0,05 (с использованием уникетола в MATLAB). Эти уникальные наборы затем использовались в качестве отправных точек для задачи оптимизации. Из 981 уникальных начальных точек 359 сходились к набору параметров, который соответствовал всем четырем условиям, и 138 из них были признаны уникальными с допуском 0,05.

Цепь кортико-гиппокампа, синаптическая пластичность и память

Abstract

Синаптическая пластичность служит клеточным субстратом для хранения информации в центральной нервной системе.Энторинальная кора (ЭК) и гиппокамп — это взаимосвязанные области мозга, поддерживающие основные когнитивные функции, важные для формирования и восстановления декларативных воспоминаний. Здесь мы обсуждаем, как информационный поток в петле ЭК-гиппокамп организован с помощью схемотехники. Мы выделяем недавно выявленные связи кортико-гиппокампа и внутригиппокампа и то, как эти дальнодействующие и локальные микросхемы способствуют обучению. В этом обзоре также описаны различные формы зависимых от активности механизмов, которые изменяют силу синаптической передачи кортико-гиппокампа.Ключевым моментом, который следует вывести из этих исследований, является то, что структурированная активность и взаимодействие совпадающих входных данных порождают ассоциативную пластичность и долгосрочное регулирование информационного потока. Наконец, мы предлагаем понимание того, как связанная с обучением синаптическая пластичность в кортико-гиппокампальном контуре во время сенсорного опыта может способствовать адаптивному поведению для кодирования пространственных, эпизодических, социальных и контекстных воспоминаний.

С момента описания Сковиллом и Милнером (1957) глубокой антероградной амнезии у пациента H.M. После двусторонней резекции височной доли гиппокамп и окружающие его структуры височной доли были тщательно изучены на предмет их роли в хранении памяти (Squire and Wixted 2011). Спустя пятнадцать лет после этого первоначального открытия наше понимание нейрофизиологических основ функции гиппокампа было значительно усилено двумя открытиями: открытием Блисса и Ломо (1973) зависимой от активности долгосрочной потенциации (ДП) синаптической передачи в гиппокампе и открытие клеток места гиппокампа, нейронов, кодирующих пространственное положение животного, О’Кифом и Достровским (1971).Эти открытия стимулировали ряд последующих достижений в нашем понимании различных форм долговременной синаптической пластичности на разных этапах обработки информации в кортико-гиппокампе и того, как такая пластичность способствует хранению памяти и пространственному представлению.

Изменения в синаптической эффективности в конечном итоге действуют путем изменения потока информации через нейронные цепи. Таким образом, более глубокое понимание того, как синаптическая пластичность может поддерживать кодирование памяти, требует детального знания путей информационного потока через кортико-гиппокампальный контур и того, как нейронная активность влияет на такую ​​обработку информации.Поскольку в последнее время был опубликован ряд превосходных обзоров о важности различных форм синаптической пластичности гиппокампа для обучения и памяти (Morris et al., 2013; Bannerman et al., 2014), мы в основном сосредоточились на недавних исследованиях, выясняющих новые особенности кортико-гиппокампа. схема и новые формы пластичности, настроенные на динамику этой схемы.

ПОТОК ИНФОРМАЦИИ ЧЕРЕЗ КОРТИКОГИППОКАМПАЛЬНЫЙ КОНТУР

Гиппокамп важен как для пространственных, так и для непространственных форм декларативной или явной памяти (Squire et al.2004), наше знание людей, мест, вещей и событий. Помимо кодирования пространственной информации (Burgess and O’Keefe 1996), нейроны гиппокампа могут также кодировать время во время эпизодических событий (Pastalkova et al. 2008; Kraus et al. 2013; Macdonald et al. 2013). Как гиппокамп кодирует и хранит эти разнообразные воспоминания? Хотя окончательного ответа нет, наши знания о кортико-гиппокампальном контуре значительно расширились за последние годы, что дает нам новое представление о множественных путях, по которым информация обрабатывается в гиппокампе, что является важным шагом на пути к пониманию того, как эта область мозга хранит воспоминания.

Нейроны соединяются во время разработки, чтобы сформировать схемы, которые обеспечивают архитектурную основу для информационного потока в мозгу, позволяя одной области мозга влиять на другую. Обучение требует объединения информации из разных коактивных областей мозга во время сенсорного опыта или повторной обработки внутренних представлений. Такие ассоциации приводят к пластическим изменениям синаптических и общеклеточных функций, которые позволяют формировать преимущественно связанные клеточные сборки. На уровне отдельного нейрона это может происходить путем интеграции и ассоциации входов, совпадающих во времени или пространстве, чтобы влиять на выход нейрона.

Как первоначально определил Lorente de Nó (1934), область гиппокампа состоит из нескольких подобластей, включая зубчатую извилину (DG) и области CA3, CA2 и CA1 собственно гиппокампа. В головном мозге крысы, по оценкам, имеется ~ 1000000 гранулярных нейронов DG, 300000 пирамидных нейронов CA3, ~ 30 000 пирамидных нейронов CA2 и 300000 пирамидных нейронов CA1 (Amaral and Witter 1989). В дополнение к этим возбуждающим основным нейронам в гиппокампе существует множество классов тормозных нейронов, хотя общее количество этих тормозных интернейронов составляет всего около 10-20% от числа основных клеток.Только в CA1 более 20 типов ГАМКергических интернейронов были классифицированы в соответствии с их морфологией, расположением, молекулярными и электрофизиологическими свойствами и синаптическими мишенями (Klausberger and Somogyi 2008). Ключевой целью исследований гиппокампа является понимание того, как эти различные субрегионы обрабатывают свои входные данные во время обучения для генерации выходных данных, способствующих различным аспектам кодирования памяти.

Цепь кортико-гиппокампа. I: Classical Pathways

Типичный пирамидный нейрон CA1 у крысы получает в общей сложности около 30 000 глутаматергических синаптических входов, распределенных по его дендритному дереву.Кроме того, он получает около 1700 ГАМКергических входов (Megias et al. 2001). Основным источником глутаматергического входа в гиппокамп является энторинальная кора (ЭК), полимодальная сенсорная ассоциативная область, которая передает как непространственную сенсорную информацию (от латеральной энторинальной коры [LEC]), так и пространственную информацию (от медиальной энторинальной коры [MEC] ). Эта сенсорная информация затем обрабатывается в гиппокампе несколькими параллельными цепями, в конечном итоге покидая гиппокамп через CA1, основной выходной путь (van Strien et al.2009 г.).

Одна поразительная особенность некоторых нейронов в слоях II и III EC (EC LII и LIII), называемых ячейками сетки, заключается в том, что они демонстрируют пространственно настроенные схемы возбуждения, состоящие из гексагонально разнесенного массива похожих на сетку полей возбуждения, которые покрывают протяженность двумерной среды (Fyhn et al. 2004; Hafting et al. 2005; Buzsaki and Moser 2013). Конвергентный ввод от ряда ячеек EC-сетки со слегка смещенными полями возбуждения был предложен для создания интерференционной картины, которая дает начало единственному четко определенному полю места клетки места гиппокампа (O’Keefe and Burgess 2005; Solstad et al. al.2006; Буш и др. 2014).

Информация из поверхностных слоев EC достигает CA1 как прямым, так и косвенным путем () (van Strien et al. 2009). Наиболее хорошо описанный маршрут — это косвенный поток информации через трисинаптический путь. В этой глутаматергической цепи звездчатые клетки EC LII посылают возбуждающие проекции через перфорантный путь (PP) к гранулярным клеткам DG, чьи замшелые выступы волокон возбуждают пирамидные нейроны CA3, которые, в свою очередь, возбуждают пирамидные клетки CA1 через коллатеральный путь Шаффера (SC). (EC LII → DG → CA3 → CA1).В дополнение к трисинаптическому пути пирамидные нейроны CA1 также получают прямую глутаматергическую проекцию от пирамидных нейронов EC LIII через темпораммонический или PP (PP, EC LIII → CA1).

Классические глутаматергические цепи кортико-гиппокампа. Классический кортико-гиппокампальный контур включает глутаматергический вход от поверхностных энторинальных слоев коры (EC) (LII и LIII) к пирамидным нейронам CA1 через трисинаптический и моносинаптический пути; Задние выступы гиппокампа в глубокие слои ЭК завершают петлю.Сенсорные сигналы управляют входными сигналами перфорантного пути (PP, фиолетовый) от пирамидных нейронов EC LIII к дистальным дендритам пирамидных нейронов CA1 (голубой). Активированные пирамидные нейроны EC LII отправляют входные данные в зубчатую извилину (DG, черный), которая отправляет аксоны мшистых волокон (темно-зеленый) в CA3, а затем CA3 питается нейронами CA1 через коллатеральные входы Шаффера (SC, темно-красный) возбуждающие входы. Основной выход гиппокампа происходит от пирамидных нейронов CA1, которые проецируются в боковые желудочки (LV) ЭК. Существует временная задержка 15-20 мс для передачи информации от EC LII к CA1 по трисинаптическому пути по сравнению с таковой от EC LIII к CA1 по моносинаптическому пути.

Эти прямые и непрямые входы кортико-гиппокампа нацелены на отдельные области дендритного дерева пирамидных нейронов CA1, при этом входы SC непрямого пути формируют синапсы в более «проксимальных» областях апикальных дендритов пирамидных нейронов CA1 в слое CA1, известном как stratum radiatum (SR). Напротив, прямые входы PP из EC образуют синапсы на «дистальных» областях апикальных дендритов пирамидных нейронов CA1 в слое, известном как stratum lacunosum молекулярный (SLM). В результате различного расположения дендритов эти два входа обеспечивают разные уровни возбуждающего возбуждения, частично из-за дифференциального затухания из-за свойств дендритного кабеля, при этом синапсы PP прямого пути обеспечивают слабое возбуждение в соме по сравнению с обеспечиваемым сильным возбуждением. входами SC непрямого пути.Эти два класса глутаматергических входов также активируют ряд различных классов ГАМКергических интернейронов, которые ингибируют выход CA1 прямым образом ().

Локальные и дальнодействующие ГАМКергические связи. CA1 имеет несколько локальных ГАМКергических интернейронов (красный). Они нацелены на сому, аксон и дендрит пирамидного нейрона CA1, чтобы модулировать активность пирамидного нейрона доменно-специфическим образом. Ингибирующие микросхемы, связанные с коллатералями Шаффера (SC) и энторинальной корой (EC), обеспечивают прямое ингибирование, тогда как подавление обратной связи задействуется повторно, когда пирамидный нейрон CA1 запускает потенциал действия.Тормозящие выступы дальнего действия (зеленые) от EC обеспечивают прямое ингибирование преимущественно локальным интернейронам (IN) в CA1. Также были описаны дальнодействующие проекции от ГАМКергических нейронов в слое ориентирования (SO) гиппокампа на слой II / III (LII / LIII) ЭК.

Цепь кортико-гиппокампа. II: Neoclassical Pathways

Более поздние результаты показывают, что в дополнение к их классическим сигналам от CA3 и EC, нейроны CA1 также получают сильный возбуждающий сигнал от области CA2 гиппокампа (CA2 → CA1) (Chevaleyre and Siegelbaum 2010), a относительно небольшая область, расположенная между CA3 и CA1 ().Хотя область CA2 была впервые идентифицирована Лоренте де Но в 1934 году, она осталась относительно неизученной, отчасти из-за своего небольшого размера и переходного положения между CA3 и CA1. Однако недавние исследования с использованием генетических подходов ясно показывают уникальную молекулярную идентичность пирамидных нейронов CA2 (Lein et al.2005; Hitti and Siegelbaum 2014; Kohara et al.2014) и предполагают важность области CA2 в определенных функциях гиппокампа (Piskorowski and Chevaleyre 2012).

Обновленный контур кортико-гиппокампа.Эта принципиальная схема объединяет недавно обнаруженные глутаматергические входы из энторинальной коры (ЭК) в гиппокамп, а также связи внутри гиппокампа. В дополнение к классическим трисинаптическим (EC слой II [LII] → зубчатая извилина [DG] → CA3 → CA1, сплошная линия) и моносинаптическим (EC слой III (LIII) → CA1, крупные пунктирные линии) путей информационного потока, CA1 также получает моносинаптические проекции от LII медиальной энторинальной коры (MEC) (маленькая пунктирная линия), а CA2 получает прямые входные данные от LII как MEC, так и латеральной энторинальной коры (LEC) (пунктирные линии).Внутри гиппокампа CA2 посылает важные входные данные в CA1, нацеленные на дендритные домены (stratum oriens [SO] / stratum radiatum [SR]) (красный), которые перекрываются с входами CA3 → CA1. CA2 также получает слабые данные от DG и CA3. Толщина линий со стрелками подчеркивает прочность входного соединения.

Подобно нейронам CA1, пирамидные нейроны CA2 получают как прямой ввод от нейронов EC LII (EC LII → CA2) на свои дистальные дендриты (Cui et al.2013; Hitti and Siegelbaum 2014), так и косвенный ввод от пути CA3 SC (EC LII → DG → CA3 → CA2) на свои проксимальные дендриты (Chevaleyre and Siegelbaum 2010).Кроме того, CA2 также получает более слабый возбуждающий сигнал из мшистых волокон непосредственно от гранулярных клеток DG (EC LII → DG → CA2) (Kohara et al. 2014).

В отличие от CA1, пирамидные нейроны CA2 гораздо сильнее возбуждаются своим прямым входом EC по сравнению с входом SC (Chevaleyre and Siegelbaum 2010). Кроме того, пирамидный нейрон CA2 образует прочную многоквантную синаптическую связь с пирамидным нейроном CA1, вызывая возбуждающий постсинаптический потенциал (ВПСП), который значительно превышает уникальный ответ на синаптическую связь между пирамидными нейронами CA3 и CA1 (Chevaleyre and Siegelbaum 2010 ).В результате CA2 опосредует мощную дисинаптическую цепь, напрямую связывающую кортикальный вход с выходом гиппокампа (EC → CA2 → CA1), который действует параллельно трисинаптическому пути. Хотя CA2, в принципе, может участвовать в квадрисинаптическом пути, связывающем EC с CA1 (EC → DG → CA3 → CA2 → CA1), сильное прямое ингибирование от CA3 к CA2 обычно ограничивает эффективный поток информации по этому пути.

Более свежие данные свидетельствуют о существовании дополнительного прямого пути от EC к CA1 () с участием проекций пирамидных нейронов LII MEC (EC LII → CA1) (Kitamura et al.2014). Эти входы также нацелены на дистальные дендриты пирамидных нейронов CA1, но они более слабые по сравнению с входами EC LIII. Кроме того, проекции EC LII обеспечивают сильный возбуждающий драйв локальным интернейронам CA1, таким образом задействуя выраженное прямое ингибирование на пирамидных нейронах CA1. Помимо возбуждающих входов LII и LIII в CA1, MEC также посылает прямые GABAergic входы во все поля гиппокампа () (Melzer et al. 2012). Эти ингибирующие проекции, вероятно, берут начало в LII / III EC и демонстрируют склонность к иннервации ГАМКергических интернейронов гиппокампа вблизи границы SR / SLM в CA1.

Возможная функция параллельных потоков информации кортико-гиппокампа

Какова цель параллельных потоков информации кортико-гиппокампа? Действуют ли различные подполя гиппокампа (DG, CA1, CA2 и CA3) как полунезависимые параллельные блоки обработки информации? Отличается ли информация, полученная этими соседними подполями, по своему сотовому происхождению или по качеству? Или подполя гиппокампа действуют в первую очередь как станции последовательной обработки, которые дискретно и последовательно преобразуют корковые данные?

Тот факт, что CA1 объединяет прямое представление пространственной и непространственной сенсорной информации (происходящей из MEC и LEC) с информацией, которая была обработана через гиппокампальные дисинаптические и трисинаптические цепи, привел к идее, что CA1 выполняет сравнение между непосредственным пространственно-сенсорным контекст и хранимая мнемоническая информация.Однако характер сравнения неизвестен.

Одно из предположений состоит в том, что CA1 действует как детектор новизны, сравнивая сохраненную информацию, относящуюся к памяти, в DG и CA3 с текущими прямыми сенсорными репрезентациями от EC (Lisman and Grace 2005; Duncan et al. 2012). Сильное подавление с прямой связью, запускаемое прямыми входами EC, может служить в качестве препятствия для информационного потока, поступающего от входов SC, посредством действия дофаминергических сигналов новизны (Lisman and Grace 2005).Другое предположение состоит в том, что прямые входы могут обеспечивать поучительные сигналы для оценки значимости информационного потока через трисинаптический путь с использованием правила пластичности, зависящего от времени, которое настроено на архитектуру линии задержки гиппокампа (Дудман и др., 2007). . Из-за двух дополнительных синапсов и задержек проведения и интеграции информация, проходящая по трисинаптическому пути, достигает нейронов CA1 примерно через 15-20 мс после поступления информации через прямые входы EC (Yeckel and Berger 1990).Такая схема позволяет интегрировать и сравнивать координированные во времени входные данные, которые могут способствовать кодированию последовательных эпизодических событий (Дудман и др., 2007; Ахмед и Мехта, 2009; Мизусеки и др., 2009; Басу и др., 2013).

Цепь кортико-гиппокампа. III: Выходы пирамидных нейронов гиппокампа

CA1 обеспечивают основной выход из гиппокампа, посылая проекции в ряд областей мозга, включая соседний субикулум, периринальную кору, префронтальную кору и миндалевидное тело (van Groen and Wyss 1990).Небольшая часть пирамидных нейронов из дорсомедиального CA1 также проецируется в рестросплениальную кору (Wyss and Van Groen 1992). Один особенно сильный выходной сигнал возвращается к EC, в котором аксоны CA1 возбуждают пирамидные клетки слоя V, которые, в свою очередь, посылают входную возбуждающую обратную связь в EC LII / III, тем самым завершая EC → гиппокамп → петлю EC (и) (Naber et al. 2001). Помимо возбуждающих пирамидных нейронов, некоторые ГАМКергические нейроны в определенных слоях CA1 проецируются непосредственно в ретрогиппокампальные и корковые области.К ним относятся дальнодействующие ГАМКергические проекции от соматостатина (SOM) и mGluR1a, экспрессирующих тормозные нейроны в ориентированном слое (SO), в субикулум и медиальную перегородку (MS) (Jinno et al. 2007; Fuentealba et al. 2008). ГАМКергические клетки, расположенные на границе SR и SLM (часто экспрессирующие мускариновые AChRs или mGluR1as) проецируются в ретросплениальную кору и indusium gresium (Jinno et al. 2007). Также существуют ГАМКергические нейроны, экспрессирующие SOM, в SO CA1 и воротах DG, которые посылают прямые проекции в поверхностные слои MEC () и полосатое тело (Melzer et al.2012). Тормозящие выступы дальнего действия часто сильно миелинизированы (Jinno et al. 2007) и преимущественно нацелены на локальные ГАМКергические интернейроны в сайтах проекций (Melzer et al. 2012). Эти свойства привели к предположению, что дальнодействующие ингибирующие проекции могут быть важны для координации времени между гиппокампом и его корковыми мишенями (Buzsaki and Chrobak 1995) и могут выполнять тормозящую роль (Caputi et al. 2013).

В настоящее время существуют противоречивые данные относительно того, проецируются ли нейроны CA2 за пределы гиппокампа.Одно исследование с использованием стратегии ретроградного отслеживания вируса бешенства, специфичного для клеточного типа, показало, что пирамидные нейроны CA2 посылают проекции на нейроны LII EC (Rowland et al., 2013), источник прямого коркового входа в CA2 (Hitti and Siegelbaum 2014; Kohara et al. др.2014). Сообщалось также, что CA2 проецируется в супраммиллярное ядро ​​(Cui et al., 2013), область гипоталамуса, которая, как давно известно, вносит значительный вклад в CA2 (Haglund et al.1984; Vertes 1992; Magloczky et al.1994; Ochiishi et al. 1999; Kiss et al.2000).

Цепь кортико-гиппокампа. IV: Неоднородность в популяции пирамидных нейронов CA1

Хотя многие исследования рассматривают пирамидные нейроны CA1 как однородную популяцию, появляется все больше доказательств неоднородности вдоль каждой из трех пространственных осей гиппокампа: семенно-височной (или дорсовентральной) продольной оси, проксимодистальная поперечная ось (CA2 к субикулюму) и глубокая поверхностная радиальная ось в слое тела клеток stratum pyramidale (SP) (при этом глубокая относится к пирамидным нейронам, более близким к SO, а поверхностная относится к пирамидным нейронам, более близким к SR).

Вдоль поперечной оси проксимальные нейроны CA1 (ближе к границе CA2) получают прямой вход в основном из MEC, тогда как дистальные нейроны CA1 (ближе к границе с субикулумом) получают прямой вход в основном из LEC () (Ishizuka et al. 1990; Виттер и Амарал 1991). Это топографическое расположение в субикулуме перевернуто. Пирамидные нейроны в CA1 и субикулюме также демонстрируют сильный проксодистальный градиент от регулярного возбуждения в CA1 до выраженного импульсного возбуждения в субикулюме (и CA3) (Jarsky et al.2008; Ким и Спрастон 2012).

Заметные различия в возбуждающих свойствах пирамидных нейронов вдоль поперечной оси также были зарегистрированы in vivo. Таким образом, дистальные пирамидные нейроны CA1, которые получают в основном непространственный вход от LEC, демонстрируют рассредоточенное возбуждение во время пространственной навигации и, как правило, имеют несколько полей позиций (Henriksen et al. 2010) и демонстрируют повышенную связь 20-40 Гц с LEC во время пространственной ассоциации. обучающее поведение (Игараши и др., 2014). Как и ожидалось, возбуждение проксимальных пирамидных нейронов CA1 более сильно связано с возбуждением нейронов MEC на тета-частотах и ​​демонстрирует большую пространственную модуляцию и более компактные пространственные поля по сравнению с их дистальными аналогами (Henriksen et al.2010).

Начиная с первых исследований Лоренте де Но (1934), было высказано предположение, что могут быть два отдельных подслоя пирамидных нейронов CA1 вдоль радиальной оси: относительно плотный поверхностный слой (ближе к SR) и более широкий, более рассредоточенный, глубокий слой. слой (ближе к SO) (Сломянка и др., 2011). Молекулярные доказательства, подтверждающие эту точку зрения, получены из открытия, что поверхностные нейроны, но не глубокие пирамидные нейроны, обогащены кальбиндином и цинком (Baimbridge and Miller 1982; Baimbridge et al.1982; Донг и др. 2008; Сломянка и др. 2011). Во время развития экспрессия Sox5 специфицирует пирамидные нейроны в глубоких слоях, тогда как коэкспрессия Satb2 и Zbtb20 может определять судьбу поверхностных нейронов (Nielsen et al. 2010; Xie et al. 2010). Морфологически глубокие нейроны имеют меньше косых дендритов в SR и более обширное ветвление в SO, чем поверхностные нейроны (Bannister and Larkman 1995b). Два подслоя также имеют различную взаимосвязь между входами и выходами, при этом глубокие нейроны получают предпочтительный входной сигнал от пирамидных нейронов CA2 (Kohara et al.2014) и локальные ингибирующие парвальбумин-положительные клетки корзины (Lee et al. 2014), последнее различие впервые было обнаружено Lorente de Nó (1934).

Важно отметить, что два слоя демонстрируют разные функциональные свойства in vitro и во время поведения. Присутствие в поверхностных нейронах кальбиндина, который буферизует кальций и препятствует действию ЛТБ, зависимого от N -метил-d-аспартатного рецептора (NMDAR), может привести к различиям в пластичности в двух популяциях (Arai et al. 1994; Bannister and Larkman 1995а, б).Поверхностные клетки обнаруживают большее влияние катионного тока, активируемого гиперполяризацией, Ih, который вносит вклад в интегративные свойства покоя нейронов (Jarsky et al. 2008). In vivo глубокие нейроны обнаруживают большую тенденцию к пространственной настройке во время навигации, а также более сильную модуляцию во время медленного сна (Mizuseki et al. 2011).

Наконец, существуют функциональные и структурные различия вдоль продольной оси гиппокампа, включая различия в экспрессии белка вдоль дорсовентральной оси, которые фактически определяют три отдельных региона: дорсальный, промежуточный и вентральный гиппокамп (Dong et al.2010). Кроме того, вентральные пирамидные нейроны CA1 гиппокампа более возбудимы, чем дорсальные нейроны, возможно, в результате более сильной экспрессии катионного канала HCN1 в вентральном гиппокампе (Dougherty et al. 2013).

Клетки места дорсального гиппокампа демонстрируют более точные поля мест по сравнению с клетками места вентрального гиппокампа, у которых поля мест более диффузны (Jung et al.1994), хотя это может не ухудшать способность вентрального гиппокампа кодировать пространственное положение из-за того, что более высокая частота активации вентральных клеток (Keinath et al.2014). Эта разница в размере поля места соответствует дорсовентральному градиенту увеличения размера поля сетки и расстояния в ячейках сетки MEC LII (Brun et al. 2008), которые показывают топографическую дорсовентральную проекцию гиппокампа (van Strien et al. 2009). Дорсальный и вентральный гиппокампы также различаются по своим выходам. Вентральный гиппокамп сильнее проецируется на префронтальную кору и миндалину по сравнению с дорсальным гиппокампом (Ishikawa and Nakamura 2006). Более того, эти различия отражают различные поведенческие роли этих двух регионов: дорсальный гиппокамп более важен для пространственной и контекстной памяти, а вентральный гиппокамп более важен для эмоционального и тревожного поведения (Fanselow and Dong 2010).

РОЛЬ РАЗЛИЧНЫХ РЕГИОНОВ КОРТИКОГИППОКАМПАЛЬНОГО КОНТУРА В ОБУЧЕНИИ И ПАМЯТИ

Исследования с использованием как традиционных поражений, так и сложных генетических подходов определили специфические роли отдельных элементов кортико-гиппокампального контура в обучении и памяти () и начали определять роль специфических поражений. регионы в заболевании. CA1, который обеспечивает основной выход гиппокампа, важен для большинства, если не всех, форм гиппокампально-зависимой памяти, поскольку поражения CA1 как у людей, так и у других видов млекопитающих, включая грызунов, приводят к серьезным нарушениям памяти (Zola-Morgan et al. al.1986; Сквайр 2004). В настоящее время роль гиппокампа и CA1 в воспроизведении памяти несколько неясна, поскольку некоторые пациенты с повреждением гиппокампа (включая H.M.), а также поврежденные животные способны вспоминать далекие воспоминания, сформированные до повреждения гиппокампа (Squire 2004). Однако другие пациенты с поражением CA1 гиппокампа имеют как тяжелую ретроградную, так и антероградную потерю эпизодической памяти (Bartsch et al. 2011). Более того, ряд исследований показал активацию гиппокампа, включая CA1, во время воспроизведения памяти (Rugg and Vilberg 2013).Более того, оптогенетические эксперименты показали, что временная и преходящая инактивация дорсальных пирамидных нейронов CA1 у грызунов заметно ухудшает память (Goshen et al. 2011). Это говорит о том, что длительная инактивация гиппокампа из-за генетических или физических повреждений может привести к различной степени компенсаторных изменений в других областях мозга, которые у одних людей позволяют вспомнить, но не у других.

Клеточные и сетевые корреляты поведенческого обучения. Генетические и классические поражения выяснили, как различные пути и популяции клеток, составляющие контур кортико-гиппокампа, поддерживают различные формы ассоциативного обучения и декларативных функций памяти.Все подполя, за исключением серых прямоугольников, показывают результаты поведенческих экспериментов с использованием генетически нацеленных типов клеток или вводят определенные функциональные манипуляции. Серые прямоугольники указывают на результаты, основанные на физических или химических поражениях. Как медиальный энторинальный слой коры (MEC), слой II (LII) (Kitamura et al. 2014), так и слой III (LIII) (Suh et al. 2011), глутаматергические входы в CA1 используются для условного рефлекса страха (TFC). Пирамидные нейроны CA1 (PN) (Goshen et al., 2011), пирамидные нейроны CA3 (Nakashiba et al.2008), зубчатая извилина (DG), гранулярные клетки (Nakashiba et al. 2012; Kheirbek et al. 2013), парвальбуминовые (PV) интернейроны (IN) (Donato et al. 2013) и интернейроны соматостатина (SOM) (Lovett- Barron et al., 2014) все участвуют в контекстуальном поведении, основанном на обучении страху. Пространственная рабочая память требует активности проекций пирамидных нейронов MEC LIII на CA1 (Suh et al. 2011; Yamamoto et al. 2014), интернейронов CA1 PV (Murray et al. 2011) и проекций вентральных гиппокампа на префронтальную кору (Wang и Cai 2006).

Одно удивительное открытие состоит в том, что повреждения дорсальной CA1 ведут к нарушению паттернов пространственной настройки решетчатых клеток внутри EC, которые обеспечивают основной вклад в гиппокамп (Bonnevie et al. 2013). Кроме того, активность клеток места гиппокампа может предшествовать появлению четко выраженных возбуждений клеток сетки EC во время раннего постнатального развития (Langston et al. 2010; Wills et al. 2010). Эти результаты предполагают, что обратная связь от гиппокампа может быть необходима для оптимального формирования поля сетки.Поскольку «пограничные клетки», которые срабатывают, когда животное достигает границ окружающей среды, развиваются в ЭК раньше ячеек сетки, было высказано предположение, что эти пограничные клетки могут обеспечивать вход, который дает начало клеткам места гиппокампа (Bjerknes et al. 2014). . Кроме того, удаление входов CA1 в EC преобразует ячейки сетки в ячейки направления головы (Bonnevie et al. 2013).

В отличие от глубоких изменений, вызываемых поражениями в CA1, поражения DG, по-видимому, вызывают более тонкие изменения в работе памяти.Хотя такие поражения не нарушают основную форму контекстуальной обусловленности страха, они действительно приводят к нарушению способности различать тесно связанные среды, процесс, называемый разделением паттернов (Leutgeb et al., 2007; Sahay et al., 2011; Nakashiba et al. 2012), способность различать близкородственные среды. Интересно, что DG является важным участком нейрогенеза взрослых (Drew et al., 2013), и новорожденные нейроны, по-видимому, преимущественно участвуют в разделении паттернов (Nakashiba et al.2012). DG также преимущественно поражается во время возрастной потери памяти (Small et al. 2011; Pavlopoulos et al. 2013), тогда как болезнь Альцгеймера первоначально поражает ЭК (Braak and Braak 1985). Интересно, что недавнее исследование (Kheirbek et al. 2013) с использованием оптогенетической активации и молчания гранулярных клеток показывает, что дорсальный DG важен для кодирования, но не для восстановления контекстных воспоминаний о страхе. Исследования генетического нокаута показывают, что CA3 важен для завершения паттернов (Nakazawa et al.2002), способности вспоминать частичные сигналы и однократных форм контекстного обучения (), в которых сильный отвращающий стимул приводит к быстрой памяти. формирование без обычной необходимости в повторных испытаниях и пространственной справочной памяти.

Первичная роль трисинаптического пути в формировании памяти и пространственном кодировании была поставлена ​​под сомнение физическими (Brun et al., 2002) и генетическими (Nakashiba et al. 2008) исследованиями поражений, которые показали, что удаление CA3, входящего в CA1, имеет на удивление слабый эффект на производительность пространственной справочной памяти в водном лабиринте Морриса (MWM) или на скорость срабатывания плацебо-клетки нейрона CA1 in vivo. Чтобы объяснить эти находки, было постулировано, что прямых входов EC LIII (и, возможно, EC LII) в CA1 может быть достаточно, чтобы управлять нормальной частотой активации CA1, чтобы поддерживать память, зависящую от гиппокампа.

В подтверждение важности прямых входов EC LIII в пространственную память было обнаружено, что химические и электролитические нарушения входов MEC в CA1 приводят к ухудшению точности пространственно-поля (Brun et al. 2008) и дефициту консолидации. пространственной долговременной памяти (Remondes and Schuman 2004). Тем не менее, высокоселективные генетические поражения или оптогенетическое подавление глутаматергических входов MEC LIII в CA1 нарушают условную рефлексию страха (TFC), форму временной ассоциативной памяти и пространственной рабочей памяти, но не нарушают пространственную справочную память, контекстуальную обусловленность страха или место -cell firing () (Сух и др.2011; Китамура и др. 2014; Ямамото и др. 2014). Недавно идентифицированные проекции пирамидных нейронов EC LII на CA1 также участвуют в отслеживании обучения страху, но играют противоположную роль входам EC LIII, подавляя память о страхе, рекрутируя популяцию дендритных, нацеленных на CA1-ингибирующие нейроны (Kitamura et al., 2014).

Предположение о том, что прямые входы EC в CA1 могут компенсировать потерю входов CA3, трудно согласовать с выводом о том, что прямые входы EC в CA1 обеспечивают только слабый возбуждающий драйв и, следовательно, не могут вызывать выход CA1, за исключением случаев, когда стимуляция высока. -частотные всплески (Jarsky et al.2005). Одно альтернативное объяснение состоит в том, что остаточная функция пирамидных нейронов CA1 и выполнение задач памяти после поражений CA3 поддерживается за счет активности через дисинаптический путь, опосредованный CA2. Однако, когда выходной сигнал пирамидных нейронов CA2 подавлялся с использованием Cre-зависимого вирусного вектора для экспрессии столбнячного токсина в линии мышей Amigo2-Cre, в пространственной эталонной памяти (MWM), распознавании объектов или запахов (включая социальные запахи) не было больших изменений. или контекстная память (контекстная обусловленность страха).Удивительно, но инактивация CA2 действительно вызвала глубокий дефицит социальной памяти, способности животного узнавать и запоминать отдельных представителей своего вида () (Hitti and Siegelbaum 2014). Роль гиппокампа в социальной памяти человека хорошо иллюстрируется случаем H.M., который больше не мог формировать воспоминания о новых людях после резекции височной доли (Corkin 2002).

Обнаружение того, что пространственная и контекстная обусловленность страха остается неизменной после повреждения всех трех основных классов входов в CA1, несколько удивительна и может указывать на то, что один или два входных пути могут поддерживать емкость памяти в отсутствие третьего. путь.Возможно, это объясняет, почему существуют параллельные маршруты обработки информационного потока от ЭК к гиппокампу, которые достаточны, но не необходимы для поддержания критических функций гиппокампа, а именно пространственного и контекстного кодирования. Другая возможность заключается в том, что долгосрочные поражения и генетические абляции, специфичные для определенного типа клеток, могут приводить к компенсаторным механизмам, которые приводят к усилению или перераспределению функционального прироста более слабых путей, что позволяет им поддерживать функцию поврежденного контура.Исследования, использующие точную по времени инактивацию пар областей и входов гиппокампа, могут помочь определить, действительно ли разные области обеспечивают такую ​​компенсацию.

ВНЕГИППОКАМПАЛЬНАЯ И НЕЙРОМОДУЛЯТОРНАЯ НАСТРОЙКА КОРТИКОГИППОКАМПАЛЬНЫХ ЦЕПЕЙ ВО ВРЕМЯ ОБУЧЕНИЯ И ПАМЯТИ

Есть несколько нейромодулирующих входов в различные подполя гиппокампа, которые сильно влияют на синаптическую передачу и активность в цепи обучения кортико-гиппокампа.Эти прогнозы часто нацелены на определенные субпопуляции ГАМКергических интернейронов в дополнение к их глутаматергическим аналогам. Кроме того, существуют существенные различия в паттернах иннервации и поведенческой активности таких входов.

Аминергические модулирующие сигналы от среднего мозга и ствола мозга могут заметно изменить функцию различных элементов цепи и модулировать формирование памяти. Важность дофамина (DA) в регулировании краткосрочной синаптической передачи, долгосрочной пластичности, обучения и памяти привлекла большое внимание (Jay 2003; Lisman and Grace 2005).Исследования с применением ванны с дофаминергическими агонистами, как правило, сообщают о сильном подавлении прямого воздействия ЭК на СА1 с незначительным влиянием на ввод СК (Лисман и Грейс 2005; Ито и Шуман 2007).

Другие исследования показывают, что DA способствует индукции поздней фазы LTP в синапсах пирамидных нейронов SC → CA1 путем активации рецепторов D1 / D5 и повышения уровней цАМФ как in vitro (Huang and Kandel, 1995), так и in vivo ( Лимон и Манахан-Воган, 2006 г.). Более того, было обнаружено, что DA важен как для формирования памяти гиппокампа (Wilkerson, Levin, 1999; Rossato et al.2009; Bethus et al. 2010) и стабильности представлений пространственного поля (Kentros et al. 1998). Такие результаты привели к предположению, что высвобождение DA в ответ на новизну действует как сигнал вознаграждения для улучшения хранения памяти за счет увеличения относительного влияния входов SC гиппокампа на CA1 по сравнению с входами EC (Lisman and Grace 2005).

Холинергические входы также играют ключевую роль в регуляции функции и памяти гиппокампа. Недавнее исследование (Lovett-Barron et al., 2014) показало, что холинергический вход от РС активирует класс SOM-положительных дендритных нацеленных на интернейроны во время безусловного аверсивного стимула в контекстуальной задаче кондиционирования страха.Вмешательство в этот механизм, основанный на цепях, путем подавления ингибирования нацеливания на дендриты в CA1 во время предъявления безусловного стимула нарушает обучение страху (). Повышенное ингибирование на дистальных дендритах пирамидных нейронов CA1 действует для подавления любых совпадающих возбуждающих сигналов, передаваемых прямым путем EC. Исследователи постулируют, что такой механизм может быть полезен для предотвращения смешения корковой сенсорной информации, представляющей отвращающие стимулы, с представлением контекста, что позволяет вспомнить только контекст, чтобы вызвать реакцию страха.

Другой внегиппокампальный модуляторный вход в CA1 исходит от таламического ядра reuniens (NuRe), которое получает вход от префронтальной коры. Анатомические и электрофизиологические исследования показывают, что NuRe посылает возбуждающие сигналы в область SLM CA1, где он иннервирует как локальные интернейроны, так и дистальные дендриты пирамидных нейронов (Wouterlood et al.1990; Hirayasu and Wada 1992; Dolleman-Van der Weel et al. 1997, 2009). Сюй и Зюдхоф (2013) недавно обнаружили, что этот путь важен для специфичности контекстных представлений, предотвращая генерализацию воспоминаний о страхе, на основе экспериментов, в которых проекции NuRe выборочно подавлялись.

Область CA2 гиппокампа также получает нейромодулирующие входы от различных ядер среднего мозга в дополнение к входным сигналам EC LII и внутригиппокампа. К ним относятся реципрокные проекции между CA2 и супраммиллярным ядром (SUM), MS, диагональная полоса Брока (DBB), а также афферентные вазопрессинергические проекции от паравентрикулярных ядер гипоталамуса к CA2 (Cui et al. 2013; Hitti and Siegelbaum 2014) . Фактически, сильный вклад гипоталамических ядер, а также высокий уровень экспрессии рецептора аргининового вазопрессина AVPR1b, вероятно, вносят вклад в способность области CA2 участвовать в определенной цепи хранения и воспроизведения социальной памяти (Young et al. al.2006; Hitti and Siegelbaum 2014). Глобальный нокаут AVPR1b (Wersinger et al. 2002) показывает пониженную социальную память, способность запоминать взаимодействия с сородичами и пониженную временную память для порядка событий (DeVito et al. 2009). В то время как AVPR1b широко экспрессируется (хотя и на более низких уровнях) по всему мозгу, в том числе в гипоталамусе, дефицит социально мотивированного агрессивного поведения у мышей с нокаутом был частично компенсирован селективной экспрессией AVPR1b в дорсальном CA2 с использованием пространственно, но не генетически нацеленного вирусного вируса. инъекции (Pagani et al.2014). Будет интересно определить, необходима ли экспрессия AVPR1b в CA2 также для формирования социальной памяти (Hitti and Siegelbaum 2014).

ДОЛГОВРЕМЕННАЯ СИНАПТИЧЕСКАЯ ПЛАСТИЧНОСТЬ В КОРТИКОГИППОКАМПАЛЬНОМ КОНТУРЕ В ОБУЧЕНИИ И ПАМЯТИ

Одной из поразительных особенностей синапсов в центральной нервной системе, особенно в кортико-гиппокампальном контуре, является степень, до которой их сила может регулироваться в течение продолжительных периодов времени. времени за счет различных паттернов синаптической активности, процесс, называемый синаптической пластичностью, зависящей от активности.В некоторых случаях пластичность является гомосинаптической в ​​том смысле, что активность в пределах данного синаптического пути приводит к изменению силы синаптической коммуникации в тех же синапсах, которые были активированы (A, B). Другие примеры синаптической пластичности являются гетеросинаптическими в том смысле, что активность одного синаптического пути влияет на функцию другого пути (C). Хотя существует множество коррелятивных доказательств, связывающих формы пластичности с формированием памяти, зависящей от гиппокампа, точная роль механизмов пластичности в обучении и формировании памяти остается спорной (см. Обзоры Morris 2013; Bannerman et al.2014). Эта сложность, вероятно, отражает тот факт, что существует несколько форм пластичности, которые различаются характером активности, необходимой для их индукции, молекулярными механизмами как их индукции, так и экспрессии, а также продолжительностью пластических изменений ().

Мотивы синаптического обучения и их временная точность. Схема, показывающая, как различные правила синаптического обучения возникают в микросхеме CA1 из-за временной паттернированной активности синаптических входов (входы от CA3 к CA1 Schaffer collateral [SC] показаны черным; входы энторинальной коры [EC] к CA1 — фиолетовым) и постсинаптического пирамидного нейрона CA1 ( синий).( A1 ) Долгосрочная потенциация высокочастотной стимуляции (HFS LTP) — это гомосинаптическая форма синаптического обучения, при которой сильная тетаническая стимуляция (200 импульсов при 20–100 Гц) входов CA3 или EC может усилить синаптический выход этот конкретный активный входной путь. HFS LTP является геббийским в том смысле, что для его индукции требуется входная стимуляция коллатералей Шаффера (SC), чтобы вызвать соматические спайки, или входная стимуляция перфорантного пути (PP) для запуска дендритных спайков в постсинаптических пирамидных нейронах CA1.( A2 ) График, изображающий частотную зависимость SC HFS LTP. Постсинаптический возбуждающий ответ, зарегистрированный в пирамидных нейронах CA1, нанесен на график как функция межстимульного интервала для тетанической стимуляции входов CA3 – CA1 SC. Исходный синаптический ответ до индукции составляет 100%. (Адаптировано, со значениями, из Thomas et al. 1996; Aihara et al. 1997; Zakharenko et al. 2003; Alarcon et al. 2004.) пирамидные нейроны за счет точного во времени спаривания синаптических входов от CA3 с постсинаптическим спайком, запускаемым инъекцией короткого текущего шага в соме.Спаривание обычно повторяется 50–100 раз при частоте 10 Гц. ( B2 ) LTP индуцируется, когда пресинаптический импульс предшествует постсинаптическому спайку на 5-20 мсек, тогда как долговременная депрессия (LTD) преобладает, когда последовательность спаривания инвертирована (постсинаптический спайк перед пресинаптическим входом). (-) Временные интервалы указывают на пре- до постсинаптического спаривания. (Адаптировано из данных Bi and Poo 1998; Debanne et al. 1998; Nishiyama et al. 2000.) ( C1 ) Пластичность, зависящая от времени входа (ITDP), индуцируется, когда входы EC и SC стимулируются с интервалом 20 мсек ( EC перед SC) с подпороговой интенсивностью (следовательно, не-Hebbian) в течение 90 секунд при частоте 1 Гц.ITDP экспрессируется в пирамидном нейроне CA1 как долговременная потенциация (LTP) SC-опосредованной постсинаптической деполяризации без изменения PP-вызванного ответа (следовательно, гетеросинаптического). ( C2 ) Индукция ITDP точно настроена на интервал спаривания в 20 мс, даже отклонение на 10 мс от этого предпочтительного временного интервала неэффективно. (-) Временные интервалы указывают EC перед объединением входов SC. (Адаптировано из данных Basu et al. 2013.)

Гомосинаптическая пластичность

Важность гомосинаптических форм зависимой от активности пластичности была впервые постулирована Дональдом Хеббом (1949) на теоретических основаниях как механизм формирования нервных ансамблей.По словам Хебба:

Когда аксон клетки A находится достаточно близко, чтобы возбудить клетку B, и неоднократно или постоянно участвует в ее возбуждении, в одной или обеих клетках происходит некоторый процесс роста или метаболические изменения, так что эффективность A как одной из клеток стрельба B, увеличивается.

Идея Хебба заключалась в том, что этот тип правила синаптического обучения обеспечит соединение нейронных сборок с общими характеристиками ответа. Например, это могло бы объяснить, как линейный массив соседних ганглиозных клеток сетчатки и их латеральных коленчатых мишеней, оба из которых имеют круговые рецептивные поля, могут подключаться к общему кортикальному нейрону в первичной зрительной коре, чтобы генерировать типичную селективность ответа на ориентированные полосы свет.Однако пластичность Хебба также идеально подходит для формирования нейронных ансамблей, кодирующих данную память.

Hebbian LTP

LTP синаптической передачи представляет собой классический пример правила синаптического обучения Hebbian. Блисс и Ломо индуцировали ДП путем кратковременной сильной тетанической стимуляции входов PP в DG у анестезированных кроликов, что приводило к длительному увеличению силы возбуждающей синаптической передачи от PP к DG, которая длилась от нескольких часов до нескольких дней (Bliss и Lomo 1973).После своего первоначального открытия было обнаружено, что LTP индуцируется почти на всех стадиях синаптической передачи в гиппокампе.

В большинстве синапсов LTP следует правилам синаптического обучения Хебба в том смысле, что он требует сильной синаптической активности, способной вызывать спайковую активность в постсинаптических клетках (Bliss and Collingridge 1993; Bliss et al. 2014). Единственным исключением является LTP из мшистых волокон от клеток гранул DG до пирамидных нейронов CA3, который, как было обнаружено в большинстве исследований, требует только пресинаптической активности без необходимости активации потенциала действия в постсинаптическом нейроне (Nicoll and Malenka 1995).Тетаническая стимуляция SC из пирамидных нейронов CA3 также индуцирует Hebbian LTP в синапсах, которые эти аксоны создают на других пирамидных нейронах CA3 (рекуррентные коллатерали), а также в их синапсах с пирамидными нейронами CA1 (A). Напротив, тетаническая высокочастотная стимуляция (HFS) обычно не индуцирует LTP в классическом смысле Хеббяна в SC-синапсах на пирамидных нейронах CA2 (Zhao et al.2007) из-за их сильной экспрессии регуляторного белка G-белка RGS14 ( Ли и др.2010) и усиление насосной активности Ca 2+ (Simons et al. 2009). Однако форма LTP была недавно описана в синапсах SC → CA2, которая полагается на подавление прямого ингибирования (см. Ниже) (Piskorowski and Chevaleyre 2013). Наконец, LTP также может быть индуцирован тетанической стимуляцией прямых входов EC в CA1 и CA2, хотя степень LTP на CA1 обычно довольно мала. Таким образом, HFS LTP является широко распространенной формой зависимой от гомосинаптической активности пластичности, обнаруживаемой во всех возбуждающих синапсах по всему контуру гиппокампа.

Наше понимание синаптических и молекулярных механизмов, лежащих в основе LTP, значительно улучшилось с момента его первоначального открытия. Однако ряд фундаментальных вопросов, касающихся основных свойств LTP, а также точной роли, которую различные формы LTP играют в обучении и памяти, остаются без ответа.

Ключевые характеристики зависимых от активности Хеббийских LTP устанавливаются свойствами NMDAR, активация которых имеет решающее значение для индукции LTP во многих синапсах, включая синапсы SC → CA1 (Collingridge et al.1983). Быстрые возбуждающие синапсы полагаются на два класса ионотропных рецепторов глутамата, NMDAR и рецепторы α-амино-3-гидрокси-5-метил-4-изоксазолепропионовой кислоты (AMPAR). NMDAR отличаются от большинства каналов, управляемых ионотропными лигандами (включая AMPAR), тем, что они требуют деполяризации мембраны в дополнение к глутаматному нейротрансмиттеру для функционирования. При типичных отрицательных потенциалах покоя поры NMDAR блокируются ионом Mg 2+ . В результате базальная синаптическая передача обычно зависит от активации AMPAR.Однако, когда пресинаптическая активность сочетается с сильной постсинаптической деполяризацией, например, во время тетанической стимуляции, NMDAR освобождаются от своей блокады Mg 2+ посредством электростатического отталкивания. NMDAR также отличаются от большинства AMPAR своей высокой проницаемостью для Ca 2+ , который действует как вторичный мессенджер внутри клеток для активации ряда нижестоящих сигнальных каскадов. В результате активация NMDAR во время сильной синаптической стимуляции вызывает повышение внутриклеточных уровней Ca 2+ , что приводит к активации Ca 2+ -кальмодулин-зависимой протеинкиназы II (CaMKII), что является критическим этапом для индукции. LTP (Malenka et al.1989; Малинов и др. 1989).

Главный вопрос, который доминировал в этой области, заключается в том, является ли LTP результатом пресинаптического изменения, включающего увеличение высвобождения глутамата, или постсинаптического изменения, возникающего в результате увеличения постсинаптического ответа на глутамат, или скоординированного изменения пресинаптического и постсинаптического характеристики. Это привело к острой полемике в этой области, которая сохраняется и по сей день. Ряд исследователей утверждают, что LTP в значительной степени является постсинаптическим, возникающим в результате внедрения AMPAR в постсинаптическую мембрану (Huganir and Nicoll 2013; Nicoll and Roche 2013).Другие утверждают, что LTP в значительной степени является пресинаптическим (Enoki et al. 2009) или представляет собой смесь отдельных пре- и постсинаптических процессов (Bliss et al. 2014).

Большая часть противоречий, вероятно, связана с тем фактом, что LTP не является унитарным явлением (Mayford et al. 2012). Скорее, нейрон может выражать несколько форм длительной синаптической пластичности, которые различаются паттерном активности, необходимой для их индукции, лежащим в основе молекулярным механизмом, временной шкалой начала и продолжительности, а также ролью в обучении и памяти ().Состояние активности, связанное с поведением, и связанная молекулярная настройка исходных входов и нижестоящих целей также будут определять способность конкретной цепи служить субстратом для пластичности, процесса, называемого метапластичностью (Abraham and Tate 1997), и тем самым позволять модулировать поток информации. Одно ясное указание на это разнообразие обеспечивается наблюдением, что определенные формы LTP, которые, по-видимому, имеют пресинаптический локус экспрессии, не требуют активации NMDAR, но в основном опосредуются притоком Ca 2+ через потенциал-управляемые кальциевые каналы (Grover и Тейлер 1990).Другим важным открытием является то, что делеция субъединицы рецептора GluR1 AMPA блокирует LTP, индуцированную тетанической стимуляцией, но только частично ингибирует LTP, вызванную стимуляцией тета-выброса (Hoffman et al., 2002), и мало влияет на синаптическую потенциацию во время зависимой от времени спайка пластичности ( STDP) (Frey et al. 2009), форма пластичности, индуцированная сочетанием EPSP с потенциалом постсинаптического действия (Markram et al. 1997).

Другое важное различие между различными формами синаптической пластичности заключается во времени и продолжительности изменения синаптической эффективности.LTP в гиппокампе имеет как раннюю, так и позднюю фазы. Например, стимуляция SC входов с использованием одной серии тетанической стимуляции (при 100 Гц в течение 1 секунды) вызывает раннюю фазу потенцирования (E-LTP), которая длится от 1 до 3 часов и не требует синтеза белка. Стимуляция четырьмя или более идентичными последовательностями, разнесенными на несколько минут друг от друга, запускает позднюю фазу потенцирования (L-LTP), которая может длиться 24 часа или более (Huang and Kandel 1994). В отличие от E-LTP, L-LTP требует синтеза нового белка, а также зависит от активации протеинкиназы A (PKA) (Frey et al.1993; Abel et al. 1997) через действие модуляторных передатчиков, таких как DA (Huang and Kandel 1995). Роль L-LTP была исследована генетически с использованием мышей, которые экспрессируют мутантный ген, который блокирует каталитическую субъединицу PKA или несет ингибирующую мутацию в гене CREB-1. Обе линии мышей имеют серьезный дефект долговременной пространственной памяти и сходные дефекты LTP. Ранняя фаза является нормальной, но поздняя фаза блокируется, что свидетельствует о связи фаз LTP с фазами хранения в памяти (Silva et al.1992; Abel et al. 1997; Бурчуладзе и др. 1998). Теоретические исследования показывают, что экспрессия различных временных фаз LTP обеспечивает стабильность следов долговременной памяти, поскольку новые воспоминания кодируются посредством продолжающихся пластических изменений синаптической функции (Fusi et al. 2005).

Долгосрочная депрессия

Присутствие LTP повышает вероятность того, что синапсы могут стать насыщенными в течение жизни животного и, таким образом, больше не смогут кодировать новые воспоминания. Эта потенциальная проблема предотвращается антагонистическими процессами депотенции и долговременной депрессии (LTD) (Bear and Abraham 1996), которые могут быть вызваны длительными периодами (5-15 минут) низкочастотной стимуляции (1-5 Гц).Депотенция относится к обращению LTP, наблюдаемому, когда низкочастотная стимуляция доставляется вскоре после индукции LTP. LTD индуцируется низкочастотной стимуляцией в отсутствие предшествующей индукции LTP. Подобно LTP, существуют также разные формы LTD. Одна известная форма требует активации NMDAR и притока постсинаптического Ca 2+ , подобно NMDAR-зависимому LTP (Bear and Abraham 1996). Другая форма LTD требует активации метаботропных рецепторов глутамата (Luscher and Huber 2010).

Каким образом приток Ca 2+ через NMDAR может по-разному запускать LTP по сравнению с LTD? Ответ, по-видимому, зависит от величины и продолжительности постсинаптического сигнала Ca 2+ с большим повышением Ca 2+ , запускающим LTP, и более продолжительным, но низким сигналом Ca 2+ , что приводит к LTD ( Неве и Цукер 1996). Эти различия могут отражать различные молекулярные механизмы LTP по сравнению с LTD, при этом LTP требует активации CaMKII, тогда как LTD требует активации кальциневрина кальмодулин-зависимой фосфатазы (Mulkey et al.1994), который активируется более низкими уровнями Ca 2+ .

Пластичность, зависящая от времени всплеска

Релевантность LTP для обучения и памяти была поставлена ​​под сомнение из-за нефизиологической длительной высокочастотной тетанической стимуляции, необходимой для ее индукции. Однако форма длительной синаптической потенциации может быть вызвана более физиологически релевантными паттернами стимуляции через STDP, включая сочетание относительно слабого пресинаптического стимула с запуском постсинаптического потенциала действия.Более того, потенцирование во время STDP показывает строгую зависимость от времени EPSP и всплеска (B) (Magee and Johnston 1997; Markram et al. 1997). Если постсинаптический спайк следует за пресинаптическим потенциалом действия на 10 мсек, синапс максимально потенцируется, что соответствует правилу обучения Хебба. Напротив, если спайк предшествует пресинаптическому стимулу, синапс становится подавленным. Если пресинаптические и постсинаптические клетки активируют потенциалы действия, разделенные на 40 мс или более, то синаптическая сила не изменяется.Эта временная зависимость согласуется со свойствами NMDAR, где запуск постсинаптического спайка, следующий, но не предшествующий высвобождению глутамата, сможет ослабить блокировку Mg 2+ , тем самым обеспечивая приток и индукцию Ca 2+ . пластичности. Таким образом, STDP обеспечивает механизм усиления или ослабления синапсов в зависимости от корреляции или антикорреляции между пресинаптической и постсинаптической активацией. Подобно LTP и LTD, STDP также требует активации NMDAR.Однако, как упоминалось выше, STDP, вероятно, задействует различные нижестоящие механизмы от LTP, индуцированного столбняком.

Роль LTP и LTD в обучении и памяти

Свойства NMDA-зависимой синаптической пластичности обеспечивают привлекательный клеточный механизм для формирования обучаемых ассоциаций. Однако было значительно труднее доказать прямую причинную связь между ДП и поведением. Первая корреляция между LTP и пространственной памятью была обеспечена демонстрацией того, что фармакологическая блокада NMDAR предотвращает формирование пространственной справочной памяти, оцененной MWM (Morris et al.1986). Важно отметить, что блокада NMDAR не повлияла на способность животного научиться подплывать к платформе, когда она видна, а для этой задачи не требуется гиппокамп. Фармакологическая блокада NMDAR также снижает стабильность полей мест в течение двух сеансов записи, разделенных 24 часами (Kentros et al. 1998).

Последующие исследования показали, что блокада NMDAR не предотвращает формирование памяти в водном лабиринте, если крыс предварительно обучили выполнению этой задачи в другой пространственной обстановке (Bannerman et al.1995; Saucier and Cain 1995). Это говорит о том, что независимых от NMDAR механизмов может быть достаточно для обучения пространственным ассоциациям при определенных условиях. Неизвестно, происходит ли пространственное обучение через не-NMDAR-зависимые формы LTP или через другой механизм.

Генетические доказательства связи LTP в области CA1 гиппокампа с обучением снова были получены в экспериментах, основанных на манипулировании функцией NMDAR. Мыши, лишенные существенной субъединицы NMDAR (NR1) в области CA1 (Tsien et al.1996) демонстрируют потерю индуцированного столбняком LTP на пути SC → CA1 и имеют глубокий дефицит MWM. Однако последующие исследования, основанные на нокауте NR1, поставили под сомнение эти первоначальные выводы (Bannerman et al. 2014). Во-первых, было обнаружено, что исходная линия мышей с делецией NR1 имеет потерю NR1 за пределами гиппокампа. Кроме того, вторая линия трансгенных мышей, в которой делеция NR1 действительно ограничивалась DG и CA1, не показала дефицита пространственной эталонной памяти, тогда как производительность пространственной рабочей памяти была нарушена (Bannerman et al.2012). Интересно, что эти мыши действительно показали трудности с повторным изучением нового местоположения платформы MWM после первоначального обучения. Этот результат привел к предположению, что NMDAR-зависимый LTP гиппокампа необходим для разрешения конфликтов между хранимой информацией и текущим сенсорным контекстом, а не для кодирования парных ассоциативных воспоминаний (Bannerman et al. 2014).

Также важно понимать, что установление связи между NMDAR и определенными задачами памяти, зависящими от гиппокампа, не обязательно означает, что формирование памяти является результатом NMDAR-зависимого LTP.Это связано с тем, что NMDAR выполняют ряд функций, помимо индукции LTP, включая генерацию поздней фазы глутаматергического ВПСП и регенеративных сигналов дендритного напряжения, называемых пиками NMDAR (Golding et al. 1999, 2002; Schiller et al. 2000). Напротив, обнаружение того факта, что фармакологическая блокада или генетическая делеция NMDAR не изменяет обучение и память при выполнении определенных задач, предполагает потенциальную роль не-NMDAR-зависимых форм LTP.

Важная линия доказательств, связывающая LTP с обучением и памятью гиппокампа, получена в экспериментах in vivo с внеклеточной записью во время обучения поведению.Например, в одном исследовании (Whitlock et al. 2006) было обнаружено, что однократное обучение с ингибирующим избеганием вызывает усиление синаптических ответов, вызванных электрической стимуляцией входов пирамидных нейронов SC → CA1. Более того, обучающее поведение вызывает те же изменения в фосфорилировании AMPAR и мембранном переносе, что и при индукции LTP с помощью тетанической стимуляции.

Хотя он менее тщательно изучен, чем LTP, несколько линий доказательств предполагают важность LTD как для обучения, так и для его исчезновения.Было обнаружено, что фармакологическая блокада NMDAR-зависимой LTD гиппокампа нарушает консолидацию долговременной пространственной памяти в MWM (Ge et al. 2010). Кроме того, Кемп и Манахан-Воган (2004) показали усиленную индукцию CA1 LTD за счет низкочастотной стимуляции, когда крысы исследовали новые объекты в новой среде. Связь между mGluR-зависимым LTD гиппокампа и обучением на объектном месте была установлена ​​в недавнем исследовании (Di Prisco et al. 2014) на мышах, несущих мутацию фактора трансляции EF2α, дефицитную по фосфорилированию.

Некоторые из лучших доказательств связи LTP и LTD с обучением и памятью получены из исследований миндалины, в которых относительно простая схема и ее роль в устоявшихся поведенческих парадигмах обеспечивают важное экспериментальное преимущество (McNally et al.2011). Ранние исследования показали, что условное кондиционирование страха, при котором животные учатся связывать тон с шоком, привело к LTP-подобному усилению синаптического ответа как на звуковой условный стимул, записанный из миндалины in vivo (Rogan et al.1997) и электрической стимуляции таламического входа в миндалину при приготовлении срезов in vitro (McKernan and Shinnick-Gallagher 1997). Подчиненное кондиционирование страха также блокировало последующую индукцию LTP в синапсах кортико-миндалевидного тела в острых срезах миндалины (Цветков и др., 2002). Интересно, что выученная реакция безопасности, в которой слуховой стимул сигнализирует об отсутствии отталкивающих стимулов, привела к LTD-подобному снижению синаптического ответа боковой миндалины на слуховой сигнал (Rogan et al.2005). Недавние эксперименты in vivo с использованием оптогенетики для прямой стимуляции кортикоталамических слуховых входов в миндалину показывают, что индукция LTD может подавлять память, обусловливающую страх, и что последующая индукция LTP может восстанавливать память о страхе (Nabavi et al. 2014), обеспечивая одни из самых сильных доказательства связи памяти с пластическими изменениями, которые усиливают или уменьшают синаптические реакции.

Тормозные цепи в пластичности, обучении и памяти

Помимо пластических изменений в возбуждающих синапсах на пирамидных нейронах CA1, ряд исследований теперь описал зависимые от активности пластические изменения в тормозных синапсах, которые эти нейроны получают.Несколько недавних исследований начали рассматривать роль торможения и ингибирующей пластичности в обучении и памяти, как обсуждается далее (см. Также недавние обзоры Kullmann et al. 2012; Wester and McBain 2014).

Одна известная форма зависимой от активности пластичности ингибирующей синаптической передачи опосредуется эндоканнабиноидным сигнальным путем (Castillo et al. 2012; Younts and Castillo 2014). Хотя сообщалось, что эндоканнабиноиды вносят вклад в LTD и LTP в возбуждающих синапсах SC в некоторых экспериментальных парадигмах (Ohno-Shosaku et al.2002; Петерфи и др. 2012), наиболее заметным действием этих сигнальных молекул является подавление ингибирования. Это является результатом пресинаптического ингибирования высвобождения ГАМК, вызванного связыванием эндоканнабиноидов с рецепторами CB1, связанными с G-белком, присутствующими на пресинаптических окончаниях холецистокинин-положительных (CCK + ) ингибирующих нейронов. Впервые было обнаружено, что эндоканнабиноиды опосредуют кратковременное подавление ингибирования, наблюдаемое после сильной постсинаптической деполяризации пирамидного нейрона CA1 (Wilson and Nicoll 2001).Более поздние исследования показали, что стимуляция тетанического или тета-всплеска SC-пути может вызывать эндоканнабиноид-зависимую LTD высвобождения ГАМК (Katona et al. 1999; Chevaleyre and Castillo 2003; Freund and Katona 2007). Интересно, что в дополнение к этим парадигмам более сильной стимуляции (Chevaleyre and Castillo 2003, 2004), эндоканнабиноидная синаптическая модуляция, опосредованная CB1R, может быть вызвана одновременным привлечением пресинаптических входов с подпороговой деполяризацией и активацией mGluR (Hashimotodani et al.2007; Basu et al. 2013). Такая опосредованная эндоканнабиноидами пластичность торможения может иметь длительный эффект, увеличивая выработку возбуждающего контура CA1 (см. Ниже) (Chevaleyre and Castillo 2004; Zhu and Lovinger 2007; Basu et al.2013; Younts et al. 2013). .

В нескольких исследованиях использовались фармакологические и генетические подходы для изучения роли CB1R в поведении, зависимом от гиппокампа. Безусловная делеция CB1R у мышей приводит к усиленным реакциям замораживания на гиппокампально-зависимые CFC и усиленному обобщению воспоминаний о страхе на сильный безусловный аверсивный стимул.Этот поведенческий эффект сопровождался увеличением LTP на входе PP в DG (Jacob et al. 2012). Свидетельства, свидетельствующие о важности CB1R гиппокампа, получены из открытия, что специфический нокдаун этих рецепторов в пирамидных клетках и интернейронах дорсального гиппокампа мыши ухудшает ассоциативное обучение во время гиппокампа-зависимого рефлекса моргания и снижает HFS-индуцированный SC LTP (Madronal et al. 2012). ).

Одно удивительное открытие было сделано в исследовании, показывающем, что избирательная делеция CB1R из астроцитов ухудшает как LTD in vivo, индуцированную каннабиноидным агонистом THC, так и производительность в версии пространственной рабочей памяти задачи MWM (Han et al.2012). Эта форма LTD также требует активации субъединицы NR2B, содержащей NMDAR, и подавления поверхностных AMPAR. Напротив, избирательная делеция CB1R из кортикальных и гиппокампальных глутаматергических или ГАМКергических нейронов вызывала небольшие изменения в рабочей памяти или эндоканнабиноид-зависимой LTD in vivo.

Как описано выше, тетаническая стимуляция обычно не вызывает классических гомосинаптических LTP в синапсах глутаматергических SC-CA2 пирамидных нейронов (Caruana et al. 2012). Однако, когда ингибирование не нарушено, высокочастотная стимуляция 10 Гц или тета-всплеском входов CA3 в CA2 может вызвать потенцирование информационного потока в этом пути.Такая активность приводит к δ-опиоид-зависимой LTD ГАМКергического прямого ингибирования, опосредованного парвальбуминовыми (PV) интернейронами. Снижение ингибирования приводит к долгосрочному усилению способности стимуляции SC возбуждать пирамидные нейроны CA2 (Piskorowski and Chevaleyre 2013).

Нейромодуляторная настройка интернейронов PV в области CA1 гиппокампа также происходит за счет действия окситоцина (Owen et al. 2013). Этот гормон усиливает спонтанную активацию бистратифицированных и корзиночных интернейронов ЛВ, что приводит к подавлению спонтанной активности в пирамидных нейронах СА1.В то же время окситоцин снижает прямое подавление на пирамидные нейроны CA1 в ответ на активацию SC входов, вероятно, в результате кратковременного синаптического подавления высвобождения ГАМК, вызванного повышенной частотой спонтанной активации. Снижение ингибирования с прямой связью усиливает активацию синаптически вызванных потенциалов действия в пирамидных нейронах CA1. Эти двойные действия окситоцина, подавляющие спонтанное срабатывание пирамидных нейронов, одновременно усиливая сетевое вызванное синаптическое возбуждение, значительно увеличивают отношение сигнал / шум при передаче информации через трисинаптический контур.

Генетическое молчание интернейронов PV в дорсальном гиппокампе приводит к дефициту пространственной рабочей памяти, но не нарушает долговременную пространственную память () (Murray et al. 2011). Хотя интернейроны ЛВ подавлялись направленными инъекциями в область СА1 вирусного вектора, экспрессирующего столбнячный токсин, некоторые из поведенческих изменений могли быть результатом экспрессии токсина в соседней области СА2, которая имеет необычно плотную популяцию интернейронов ЛВ. Выключение интернейронов PV также увеличивает частоту активации клеток места в пределах поля места и смещает синхронизацию спайков по отношению к пространственно модулированной тета-фазе; однако это не влияет на их размер поля места (Royer et al.2012).

Субпопуляция oriens-lacunosum molculare (OLM) интернейронов, экспрессирующих SOM, также, как было показано, сильно регулирует кодирование памяти. Эти нейроны расположены в SO, где они рекуррентно рекрутируются выходом пирамидного нейрона CA1 и подкорковыми холинергическими входами. Нейроны OLM отправляют свои аксоны в SLM, где они мощно ингибируют дистальные дендриты пирамидных нейронов CA1, тем самым подавляя возбуждающие эффекты прямых входов EC в CA1.Было обнаружено, что активация нейронов OLM холинергическими входами в ответ на пугающий стимул (удар стопы) важна для кодирования контекстуальной обусловленности страха (Lovett-Barron et al., 2014).

Гетеросинаптическая пластичность кортико-гиппокампа

LTP и STDP — это неконтролируемые гомосинаптические правила обучения Хебба, в которых активность одного класса возбуждающих синаптических входов изменяет эффективность тех же самых входов. Напротив, LTD мозжечка (Ito 2001) представляет собой правило гетеросинаптического контролируемого обучения, в котором считается, что активность в одном наборе возбуждающих синапсов (карабкающихся волокон) обеспечивает сигнал ошибки, который вызывает пластичность (LTD) в другом наборе возбуждающих синапсов ( параллельные волокна), который играет важную роль в определенных формах моторного обучения.Может ли сложный и конвергентный набор корковых и гиппокампальных входов в пирамидный нейрон CA1 также поддерживать зависимые от активности правила гетеросинаптического обучения?

Тот факт, что пирамидные нейроны CA1 получают как слабый прямой сенсорный ввод от EC, так и сильный обработанный или мнемонический ввод от CA3, побудил ряд групп исследовать возможную функцию этого двойного ввода. Сильная парная активация входов EC и SC противодействует индукции HFS LTP на входах SC, поскольку входы EC вызывают сильный ингибирующий ответ в пирамидных нейронах CA1 (Levy et al.1998; Ремондес и Шуман 2004). Другие группы обнаружили, что стимуляция пути SC перед активацией PP может усиливать распространение EC EPSP в соме (Jarsky et al. 2005; Ang et al. 2006).

В отличие от подавляющего эффекта входной стимуляции ЭК на SC LTP, отмеченного выше, сочетание короткого импульса 100 Гц из четырех стимулов EC с одним стимулом SC на частоте тета (5 Гц) вызывает небольшое продолжительное усиление путь SC (увеличение на 25%), когда стимул SC возникает в пределах 70 мс после окончания импульса (Judge and Hasselmo 2004).Стимуляция тета-взрывом пути EC может производить медленное, небольшое (20% -40%) усиление пути SC без изменения синаптического ответа EC (Han and Heinemann 2013). Одновременная стимуляция тета-всплеском энторинальной коры и входов SC приводит к потенциалам дендритного плато и от 30% до 60% LTP PP EPSP (Takahashi and Magee 2009).

Одна особенно интересная особенность прямых и трисинаптических входов кортико-гиппокампа в пирамидные нейроны CA1 состоит в том, что они организованы в архитектуру линии задержки, в которой информация, переносимая прямыми входами энторинальной коры, поступает в пирамидные нейроны CA1 примерно за 15-20 мсек до поступление информации, распространяющейся по трисинаптическому пути (Yeckel and Berger, 1990).Наша лаборатория (Dudman et al. 2007) изучила, может ли такая архитектура линии задержки использоваться для реализации правила синаптического обучения, зависящего от времени. Парная активация энторинальной коры и входов SC с интервалом задержки 20 мс (PP перед SC) в срезах гиппокампа вызывает удивительно большое (100–300%) потенцирование синаптического ответа SC без изменения реакции, вызванной энторинальной корой. . Напротив, пары с немного разными интервалами (10 или 30 мс) или с обратным отсчетом времени (SC перед энторинальной корой) не вызывали или не вызывали долговременной потенциации (C) (Dudman et al.2007; Basu et al. 2013). Это явление было названо входящей пластичностью, зависящей от времени (ITDP) (Dudman et al. 2007) по аналогии с STDP.

ITDP разделяет ключевые особенности с SC HFS LTP в том, что он требует притока Ca 2+ через NMDARs и некоторой постсинаптической деполяризации (Dudman et al. 2007; Basu et al. 2013). Он отличается от LTP тем, что не требует большой постсинаптической деполяризации или выхода потенциала действия CA1. ITDP также требует активации метаботропного рецептора глутамата mGluR1a и зависимого от рецептора IP 3 высвобождения Ca 2+ из внутренних хранилищ (Dudman et al.2007; Basu et al. 2013).

Что отвечает за значительное усиление синаптической передачи, наблюдаемое во время ITDP? Одно из необычных свойств ITDP состоит в том, что он может сильно индуцироваться при сохранении ингибирования. Действительно, блокада рецепторов ГАМК значительно снижает величину ITDP, указывая на важность ингибирующей синаптической передачи (Xu et al. 2012; Basu et al. 2013). Поскольку PSP, генерируемый в пирамидном нейроне CA1 в ответ на стимуляцию SC, определяется перекрывающимся SC EPSP и прямым IPSP, усиленный деполяризующий ответ во время ITDP может в принципе быть результатом либо увеличения EPSP, либо уменьшения с прямой связью IPSP.Наша лаборатория (Basu et al.2013) подошла к этому вопросу, изучив EPSP и IPSP по отдельности и обнаружив, что ITDP является результатом как длительного потенцирования EPSP (E-LTP), так и длительного угнетения IPSP (I -LTD). Более того, было обнаружено, что I-LTD является результатом избирательного снижения перисоматического ингибирования со стороны CCK-экспрессирующих интернейронов, опосредованного высвобождением эндоканнабиноидов и активацией рецепторов, связанных с G-белком CB1.

Тот факт, что ITDP сильно настроен на временную задержку для распространения информации через трисинаптические пути по сравнению с прямыми путями к пирамидным нейронам CA1, предполагает, что это может быть полезно для оценки значимости мнемонической информации, обрабатываемой через DG и CA3, в непосредственном сенсорном контексте. кодируется входами EC.Роль ITDP в обучении и памяти согласуется с дефицитом усвоенных временных ассоциаций, наблюдаемым при инактивации нейронов LIII в MEC (Suh et al. 2011; Kitamura et al. 2014), и с дефектами обучения, наблюдаемыми при делеции CB1. рецепторы, описанные выше. Возможная роль ITDP в пространственном кодировании также подтверждается его зависимостью от клеток-корзин, ингибирующих CCK, которые активируются синхронно во время пространственно настроенной тета-активности в фазе, которая предшествует запуску клеток места, когда животное входит в соответствующее поле места (Klausberger et al. .2005). Эндоканнабиноид-зависимая модуляция прямого ингибирования, опосредованного интернейронами CCK, может быть правдоподобным способом для микросхемы CA1 генерировать более высокий контраст для функционально связанных ансамблей пирамидных нейронов в зависимости от использования, например, во время контекстного или пространственного кодирования. Во время ассоциативного обучения, основанного на сенсорном опыте, ITDP может быть полезен для присвоения весов ранее сохраненным представлениям гиппокампа на основе онлайн-потока корковой сенсорной информации.

MIL-STD-1553 Учебное пособие и справочник — Aerospace DAQ, Test, HIL


Что такое MIL-STD-1553?

MIL-STD-1553 — это военный стандарт, определяющий механические, электрические и рабочие характеристики шины последовательной передачи данных для Министерства обороны США. В настоящее время он широко используется как для военных, так и для гражданских приложений в авионике, самолетах и ​​космических аппаратах для обработки данных. В системе MIL-STD-1553 обычно используется физический уровень с двойным резервированием, сбалансированная линия и дифференциальный сетевой интерфейс с мультиплексированием с временным разделением, полудуплексный протокол передачи данных команды / ответа с максимум 32 удаленными оконечными устройствами.Впервые он был использован в истребителе F-16, а в настоящее время широко используется всеми видами вооруженных сил США и НАТО.

Для получения дополнительной информации о MIL-STD-1553 посмотрите следующие видео.

Обзор MIL STD 1553

Полное решение 1553

Серия технических мастер-классов UEI: Введение в MIL-STD-1553

75 Текущий стандарт Стандарт MIL-STD-1553B был представлен в 1978 году, цель которого заключалась в том, чтобы четко определить, как должна работать каждая опция, чтобы гарантировать совместимость между производителями.

MIL-STD-1553 — это военный эквивалент ARINC-429, хотя структурно он ОЧЕНЬ отличается. Первое и наиболее очевидное отличие состоит в том, что большинство каналов 1553 имеют двойные резервные каналы. Хотя на коммерческих самолетах провода обычно не перерезаются пулями или зенитной артиллерией, военные самолеты обычно проектируются таким образом, что одиночный разрез провода или жгута проводов не приведет к потере контроля над системой. Если вы хотите «подключиться» к устройству MIL-1553, убедитесь, что в вашем интерфейсе есть оба канала.

Кроме того, устройство MIL STD 1553 может служить контроллером шины, монитором шины или удаленным терминалом. Не все интерфейсы поддерживают все три функции. Убедитесь, что выбранный вами интерфейс имеет необходимые вам возможности.

Как и в случае с шиной ARINC-429, при работе в качестве контроллера шины устройство должно иметь возможность детального планирования передачи (включая синхронизацию основных и второстепенных кадров), и это лучше всего выполнять аппаратно, а не программно.



Физическая плата ввода-вывода MIL-STD-1553

Одиночная шина 1553 состоит из экранированной пары витых проводов с сопротивлением 70-85 Ом на частоте 1 МГц.Если используется коаксиальный разъем, центральный контакт используется для двухфазного сигнала высокого уровня Манчестера. Все передающие и приемные устройства подключаются к шине либо через соединительные трансформаторы, либо напрямую через ответвительные соединители и изолирующие трансформаторы, как показано ниже. Шлейфы могут иметь длину не более 1 фута для прямого соединения или максимум 20 футов для трансформаторного соединения. Для ограничения отражений шина данных должна быть оснащена резисторами, равными характеристическому сопротивлению кабеля (в пределах ± 2%).На изображении ниже показан один из двух автобусов. Каждый трансивер таким же образом подключается ко второй (резервной) шине. Наша плата ввода-вывода 1553 имеет 2 канала. Каждый канал представляет собой независимую систему 1553, которая поддерживает шину A и шину B.

Плата ввода-вывода UEI DNx-1553-553 MIL-STD-1553 имеет 2 независимых интерфейса с двойным резервированием, BC / RT / Режимы MT, моделирование нескольких RT до 32 RT, поддерживает протоколы 1553A, 1553B (включая примечание 2) и 1553C, а также трансформатор или прямое соединение.Кликните сюда, чтобы узнать больше.

Вернуться к началу



1553 Протокол шины

Все сообщения 1553 на шине содержат одно или несколько 16-битных слов, классифицируемых как команды, данные или слова состояния . Каждому слову предшествует синхроимпульс длительностью 3 мкс, за которым следует бит нечетной четности. Обратите внимание, что поскольку синхроимпульс — низкий уровень 1,5 мкс, сопровождаемый максимальным значением 1,5 мкс — не может появиться в манчестерском коде, он уникален.Слова в сообщении передаются без промежутка между словами, но между последовательными сообщениями вставляется промежуток в 4 мкс. Все устройства должны начать передачу ответа на команду в течение 4–12 мкс. Если они не начнут передачу в течение 14 мкс, считается, что они не получили командное сообщение.

Типичная система показана ниже.

Вернуться к началу



Форматы слов

Стандарт 1553 определяет три типа слов:

Каждый тип слова имеет определенный формат в общей структуре.Все слова имеют длину 20 бит, а первые три бита являются полем синхронизации, что позволяет синхронизирующим сигналам декодирования повторно синхронизироваться в начале каждого нового слова. Следующие 16 бит содержат информацию в формате, который зависит от типа слова. Последний бит в слове — это бит четности, который основан на нечетной четности для одного слова.

Все битовое кодирование основано на двухфазном формате Manchester II, который обеспечивает самосинхронизирующийся сигнал. Сигнал симметричен относительно нуля и поэтому совместим с трансформаторной связью.

При манчестерском кодировании переходы сигналов происходят только в центре битового времени. Логический «0» определяется как переход от отрицательного к положительному уровню; логическая «1» обратная. Обратите внимание, что уровни напряжения на шине не являются информационным сигналом; вся информация содержится в времени и направлении нулевых переходов сигнала на шине.

Терминальное оборудование обеспечивает кодирование и декодирование различных типов слов. Кодировщик также вычисляет четность.Для полученных сообщений декодер сигнализирует логике, какой тип синхронизации имеет слово и действительна ли проверка на четность. Для передаваемых сообщений ввод в кодировщик определяет, какой тип синхронизации поместить в начало слова. Кодировщик автоматически вычисляет четность для каждого слова.

Форматы для каждого типа слова показаны ниже.

К началу



Командное слово

Формат командного слова использует первые 5 битов для адреса удаленного терминала (от 0 до 31).Шестой бит равен 0 для приема и 1 для передачи. Следующие 5 битов указывают биты кода подадреса / режима. Если это поле 00000B или 11111B, команда является командой кода режима. Все остальные биты направляют данные к определенным функциям в подсистеме. Следующие 5 битов определяют количество слов или код режима, который необходимо выполнить. Если это поле 00000B или 1111B, это поле определяет код режима, который будет выполняться. Если это не так, поле определяет количество слов данных, которые должны быть переданы или получены (в зависимости от бита T / R).Поле подсчета слов 00000B означает 32 слова данных.

Последний бит — это проверка на четность слов. Используется только нечетная четность.



Слово данных

Слово данных содержит информацию, передаваемую в сообщении. Первые 3 бита содержат синхронизацию данных, противоположную той, которая используется для команды или слова состояния.

Слова данных могут передаваться либо удаленным терминалом (команда передачи), либо контроллером шины (команда приема).Удаленный терминал является точкой отсчета.

Следующие 16 битов могут использоваться по желанию разработчика. Единственное стандартное требование состоит в том, что старший бит должен быть передан первым.

Последний бит — бит нечетной четности.



Слово состояния

Удаленный терминал отвечает на действительное сообщение, передавая слово состояния. Слово состояния сообщает контроллеру шины, правильно ли было получено сообщение и каково состояние терминала.

Слово состояния очищается после получения допустимого командного слова. После очистки слова состояния биты снова устанавливаются, если условия, которые изначально устанавливают биты, все еще существуют. Если в данных обнаруживается ошибка, устанавливается бит ошибки сообщения и передача слова состояния подавляется. Передача слова состояния также подавляется всякий раз, когда принимается широковещательное сообщение.

Первые 5 бит слова состояния (биты 4-8) — это адрес терминала. Удаленный терминал устанавливает эти биты на адрес, на который он был запрограммирован.Контроллер шины проверяет эти биты, чтобы убедиться, что отвечающий терминал является тем, к которому было адресовано командное слово.

Следующий бит (9) — это бит ошибки сообщения, который устанавливается терминалом при обнаружении ошибки или недопустимого сообщения. Когда этот бит установлен, никакие данные, полученные в сообщении, не используются. При обнаружении ошибки удаленный терминал должен подавить передачу слова состояния.

Инструментальный бит (10) отличает командное слово от слова состояния (оба имеют одинаковый шаблон синхронизации).Бит инструментария в слове состояния всегда установлен на «0». При использовании инструментальный бит в командном слове всегда устанавливается в «1». Поскольку этот бит является наиболее значимым битом поля подадреса, его использование в качестве бита инструментария сокращает количество доступных подадресов с 30 до 15. Из-за этого ограничения в большинстве систем сегодня используются методы, отличные от бита инструментария, для различения команд и команд. статусные слова.

Бит запроса на обслуживание (11) позволяет терминалу информировать контроллер шины о том, что он нуждается в обслуживании.«1» в этом бите указывает на необходимость обслуживания. Обычно он используется, когда контроллер шины опрашивает клеммы.

Биты 12–14 зарезервированы для использования в будущем и должны быть установлены в «0». Любое другое значение считается ошибкой.

«1» в бите 15 указывает, что терминал получил действительную широковещательную команду. Каждый раз, когда терминал принимает действительную широковещательную команду, терминал устанавливает этот бит в «1» и подавляет передачу своего слова состояния.

«1» в бите 16 (бит «занято») сообщает контроллеру шины, что терминал не может действовать по команде для перемещения данных между терминалом и подсистемой.Этот бит обычно не используется в современных системах и не рекомендуется примечанием 2 стандарта.

«1» в бите 17 используется как индикатор наличия неисправности в подсистеме. «1» в бите 18 указывает, что удаленный терминал получил код режима и принял управление шиной. После установки этого бита удаленный терминал становится контроллером шины.

«1» в бите 19 (флаг терминала) указывает контроллеру шины, что существует неисправность в аппаратном обеспечении удаленного терминала.

Посмотрите следующие видео для получения дополнительной информации.

Внедрение ошибок в трафик на шине

Внесение ошибок в слово состояния

Поиск отсутствующих данных MIL-STD-1553

Запись данных на шину из



1553 Удаленный терминал (RT)

Любое устройство, не являющееся контроллером шины или монитором шины, по определению является удаленным терминалом.

Удаленный терминал может использоваться как интерфейс между шиной (ами) и подсистемой или как соединитель между этой шиной и другой шиной 1553. Подсистема — это отправитель или пользователь информации, передаваемой по шине. Удаленный терминал содержит все компоненты, необходимые для передачи данных от отправителя-источника конечному пользователю.

Технический мастер-класс UEI: MIL-STD-1553 RT / SA


1553 Контроллер шины (BC)

Контроллер шины (BC) управляет потоком данных на шинах.Одновременно может быть активен только один контроллер шины. Контроллер шины может быть одного из трех типов: (1) Контроллер слов, (2) Контроллер сообщений или (3) Контроллер кадра.

Контроллер Word, который обрабатывает одно слово за раз, сегодня редко используется из-за вычислительной нагрузки, которую он возлагает на подсистему.

Контроллер сообщений обрабатывает одно сообщение за раз, взаимодействуя с компьютером только после завершения сообщения или при возникновении ошибки.

Контроллер кадров может обрабатывать несколько сообщений в определенной последовательности, прерывая работу компьютера только после завершения потока сообщений или после обнаружения ошибки.

Посмотрите следующее видео для получения дополнительной информации.

Технический мастер-класс UEI: MIL-STD-1553 Контроллер шины



1553 Bus Monitor (MT)

Bus Monitor не может передавать сообщения по шине ; его функция заключается в отслеживании и записи сообщений, передаваемых по шине, без нарушения работы других устройств. Монитор шины может быть настроен для записи выбранных подмножеств сообщений на шине.Его также можно настроить в качестве резервного контроллера шины, готового взять на себя при необходимости.

Посмотрите следующие видео для получения дополнительной информации.

Варианты использования монитора шины 1553 UEI

Технический мастер-класс UEI: понимание монитора шины MIL-STD-1553

К началу

90 RT с терминалом монитора или BC с терминалом монитора

Каждая плата ввода-вывода имеет 2 канала.Каждый канал представляет собой полную систему 1553 со стороной A и стороной B. Каждый канал может быть настроен как BC, RT или MT. Вы также можете добавить MT к каналу BC или RT. MT не изменяет функциональность BC или RT. MT просто позволяет вам видеть, что находится на шине для любого указанного RT или всего автобусного трафика.


Видеоуроки MIL-STD-1553

В начало


Ресурсы для загрузки по MIL-STD-1553

Будущее систем тестирования вооружения

0

9 Комплект для испытаний авиационного вооружения (CAATS) заменит 25-летний испытательный комплект Common Rack and Launcher Test Set (CRALTS) и станет новым стандартом для тестирования современных систем интеллектуального вооружения.Эта сложная система разработана с использованием оборудования United Electronic Industries (UEI) и решений ввода-вывода, которые обеспечивают надежность, гибкость ввода-вывода и долговечность.
Продукты UEI, используемые в CAATS:
Получить технический документ CAATS
Краткое справочное руководство UEI — это краткий 16-страничный буклет, в котором освещаются все гибкие и надежные аппаратные средства UEI и возможности ввода-вывода. Ознакомьтесь с разбивкой всех наших вариантов шасси, а также с полным списком всех наших вводов / выводов и спецификаций.PLUS, вы получите нашу быструю и легкую инфографику по сборке системы, которая покажет вам, как создать идеальное системное решение UEI I / O. Этот буклет поможет вам познакомиться с UEI и проиллюстрировать, как вы можете использовать наши решения для успеха приложений!
Получить краткое руководство

В начало


Сопутствующие приложения

UEI предлагает широкий спектр решений для ваших оборонных и аэрокосмических приложений. Пожалуйста, нажмите на ссылку ниже, чтобы узнать больше.

Просмотреть все приложения UEI

К началу



Источники

Кортикальная микросхема и терапевтические перспективы

Исследование спектроскопии

(

1

H-MRS). Prog Neuro-Psychopharmacol Biol

Psychiatry 31: 403–411.

21. Габбай В., Мао Х, Кляйн Р.Г., Эли Б.А., Бабб Д.С., Панцер А.М. и др.

(2012): g-аминомасляная кислота передней поясной коры головного мозга у подростков с депрессией

: связь с ангедонией.Arch Gen Psychiatry

69: 139–149.

22. Northoff G, Walter M, Schulte R F, Beck J, Dydak U, Henning A,

et al. (2007): Концентрация ГАМК в коре головного мозга человека передней поясной извилины

предсказывает отрицательные BOLD-ответы на фМРТ. Nat Neurosci

10: 1515–1517.

23. Hu Y, Chen X, Gu H, Yang Y (2013): Концентрации глутамата в состоянии покоя и

GABA предсказывают дезактивацию, вызванную задачей, в сети режима

по умолчанию. J Neurosci 33: 18566–18573.

24. Капогианнис Д., Рейтер Д.А., Виллетт А.А., Маттсон М.П. (2013): Плакат-

глутамат коры головного мозга и ГАМК прогнозируют внутреннюю функциональную связность

сети режима по умолчанию. NeuroImage 64: 112–119.

25. Вибкинг К., Дункан Н. В., Тирет Б., Хейс Д. Д., Марджа

нска М., Дойон Дж.,

и др. (2014): ГАМК в островке — предиктор нейронного ответа

на интероцептивную осведомленность. NeuroImage 86: 10–18.

26. Санакора Г., Мейсон Г.Ф., Ротман Д.Л., Бехар К.Л., Хайдер Ф.,

Петров ОАК и др.(1999): Пониженные уровни кортикальной g-аминомасляной кислоты

у пациентов с депрессией, определенные с помощью протонной магнитно-резонансной спектроскопии

. Arch Gen Psychiatry 56: 1043–1047.

27. Левинсон А.Дж., Фицджеральд П.Б., Фавалли Г., Блумбергер Д.М., Дейгл М.,

Даскалакис З.Дж. (2010): данные о кортикальных тормозных недостаточностях при большом депрессивном расстройстве

. Biol Psychiatry 67: 458–464.

28. Bajbouj M, Lisanby SH, Lang UE, Danker-Hopfe H, Heuser I, Neu P

(2006): доказательства нарушения коркового торможения у пациентов с большой полярной депрессией

.Биол Психиатрия 59: 395–400.

29. Льюис Д.А., Sweet RA (2009): Шизофрения с точки зрения нейронной схемы

: Продвижение к рациональной фармакологической терапии.

Дж. Клин Инвест 119: 706–716.

30. Хаслер Г., ван дер Вин Дж. В., Герачи М., Шен Дж., Пайн Д., Древец В. К.

(2009): Уровни префронтальной кортикальной гамма-аминомасляной кислоты при паническом расстройстве

, определенном с помощью протонной магнитно-резонансной спектроскопии.

Биологическая психиатрия 65: 273–275.

31. Голд Б.И., Бауэрс М.Б., Рот Р.Х., Суини Д.В. (1980): уровни ГАМК

в спинномозговой жидкости пациентов с психическими расстройствами. Am J Psychiatry

137: 362–364.

32. Гернер Р., Фэрбенкс Л., Андерсон Г. М., Янг Дж. Г., Шейнин М.,

Линнойла М. и др. (1984): нейрохимия спинномозговой жидкости у

депрессивных,

больных маниакальной болезнью и пациентов с шизофренией по сравнению с таковой у здоровых людей.

Am J Psychiatry 141: 1533–1540.

33. Каса К., Оцуки С., Ямамото М., Сато М., Курода Н., Огава Н. (1982):

Гамма-аминомасляная кислота в спинномозговой жидкости и гомованилловая кислота

при депрессивных расстройствах.Биологическая психиатрия 17: 877–883.

34. Berrettini WH, Nurnberger JIJ, Hare TA, Simmons-Alling S,

Gershon ES, Post RM (1983): Пониженная плазма и гамма CSF —

аминомасляная кислота при аффективном заболевании: Эффект карбоната лития.

Biol Psychiatry 18: 185–194.

35. Петти Ф., Крамер Г.Л., Гуллион С.М., Джон Раш A (1992): Низкие уровни аминомасляной кислоты в плазме g-

у пациентов мужского пола с депрессией. Biol Psy-

chiatry 32: 354–363.

36.Bjork JM, Moeller FG, Kramer GL, Kram M, Suris A, Rush AJ, Petty F

(2001): Уровни ГАМК в плазме коррелируют с агрессивностью у родственников

пациентов с униполярным депрессивным расстройством. Psychiatry Res

101: 131–136.

37. Sanacora G, Gueorguieva R, Epperson CN, Wu Y-T, Appel M,

Rothman DL, et al. (2004): Специфические подтипные изменения гамма-

,

аминомасляной кислоты и глутамата у пациентов с большой депрессией.

Arch Gen Psychiatry 61: 705–713.

38. Hasler G, Neumeister A, Van Der Veen JW, Tumonis T., Bain EE,

Shen J, et al. (2005): Нормальные уровни префронтальной гамма-аминомасляной кислоты

у пациентов с ремиссией и депрессией, определенные с помощью протонной магнитной резонансной спектроскопии

. Биол Психиатрия 58: 969–973.

39. Sanacora G, Mason GF, Rothman DL, Krystal JH (2002): Повышение концентрации ГАМК на

затылочной коры головного мозга у пациентов с депрессией после терапии

селективными ингибиторами обратного захвата серотонина.Am J Psychiatry

159: 663–665.

40. Бхагвагар З., Вилезинска М., Тейлор М., Джеззард П., Мэтьюз П.М.,

Коуэн П.Дж. (2004): Повышение концентрации ГАМК в мозге после

острого введения селективного ингибитора обратного захвата серотонина. Am J

Психиатрия 161: 368–370.

41. Dubin M, Mao X, Gordon R, Kang G, Liston C, Shungu D (2014): TMS

над левой дорсолатеральной префронтальной корой увеличивает концентрацию ГАМК в вентромедиальной префронтальной коре при большой депрессии.

Compr Psychiatry 55: e46 – e47.

42. Дубин MJ, Мао X, Banerjee S, Goodman Z, Lapidus KAB, Kang G,

et al. (2016): Повышенная ГАМК префронтальной коры у пациентов с

большим депрессивным расстройством после лечения ТМС, измеренная с помощью спектроскопии протонного магнитного резонанса

. J Psychiatry Neurosci

41: E37 – E45.

43. Санакора Г., Мейсон Г.Ф., Ротман Д.Л., Хайдер Ф., Сиарсия Дж.Дж.,

Острофф РБ и др. (2003): Повышенная концентрация кортикальной ГАМК у

пациентов с депрессией, получающих ЭСТ.Am J Psychiatry 160: 577–579.

44. Sanacora G, Fenton LR, Fasula MK, Rothman DL, Levin Y,

Krystal JH, Mason GF (2006): Концентрация кортикальной g-аминомасляной кислоты —

тераций у пациентов с депрессией, получающих когнитивно-поведенческую терапию.

Биологическая психиатрия 59: 284–286.

45. Карпентер Л.Л., Яничак П.Г., Ааронсон С.Т., Бояджис Т., Брок Д.Г.,

Кук И.А. и др. (2012): Транскраниальная магнитная стимуляция (ТМС) для

большой депрессии: многоплановое, натуралистическое, наблюдательное исследование

исходов острого лечения в клинической практике.Подавить тревогу

29: 587–596.

46. Маккормик Д.А. (1989): ГАМК как тормозящий нейромедиатор в коре головного мозга человека

. J Neurophysiol 62: 1018–1027.

47. Сангер Т.Д., Гарг Р.Р., Чен Р. (2001): Взаимодействие между двумя

различными тормозными системами в моторной коре головного мозга человека. J. Physiol

530: 307–317.

48. Di Lazzaro V, Pilato F, Dileone M, Tonali PA, Ziemann U (2005):

Диссоциированные эффекты диазепама и лоразепама на короткое время ожидания

афферентного торможения.J Physiol 569: 315–323.

49. Кирали Дж., Премоли И., Ципсер С., Белардинелли П., Циманн У., Мюллер-

Дальхаус Ф. (2016): характеристика нейротрансмиссии

в коре головного мозга человека, опосредованной ГАМК-рецептором, с помощью парно-импульсной ТМС-ЭЭГ.

Clin Neurophysiol 127: e45.

50. Roick H, von Giesen HJ, Benecke R (1993): О происхождении

пост-возбуждающего торможения, наблюдаемого после транскраниальной магнитной стимуляции мозга

у бодрствующих людей.Exp Brain Res 94: 489–498.

51. Siebner HR, Dressnandt J, Auer C, Conrad B (1998): Непрерывные

интратекальные инфузии баклофена

вызвали заметное увеличение транскраниально вызванного периода молчания на

у пациента с генерализованной дистонией

. Мышечный нерв 21: 1209–1212.

52. Premoli I, Rivolta D, Espenhahn S, Castellanos N, Belardinelli P,

Ziemann U, Müller-Dahlhaus F (2014): Характеристика рецептора GABAB-

, опосредованного рецептором

, в коре головного мозга человека парными

импульсная ТМС – ЭЭГ.NeuroImage 103: 152–162.

53. Стил Д.Д., Глабус М.Ф., Шаджахан П.М., Эбмайер К.П. (2000): усиление кортикального торможения

при депрессии: длительный период молчания с транскраниальной магнитной стимуляцией (ТМС)

. Psychol Med 30: 565–570.

54. Радху Н., де Хесус Д.Р., Равиндран Л.Н., Занджани А., Фицджеральд П.Б.,

Даскалакис З.Дж. (2013): метаанализ коркового торможения и возбудимости

с использованием транскраниальной магнитной стимуляции при психиатрических

расстройствах.Clin Neurophysiol 124: 1309–1320.

55. Chen R-S, Classen J, Gerloff C, Celnik P, Wassermann EM,

Hallett M, Cohen LG (1997): Снижение возбудимости моторной коры

с помощью низкочастотной транскраниальной магнитной стимуляции. Неврология

48: 1398–1403.

56. Daskalakis ZJ, Möller B, Christensen BK, Fitzgerald PB, Gunraj C,

Chen R (2006): Эффекты повторяющегося транскраниального магнитного стимулирования

на корковое торможение у здоровых людей.Exp Brain Res

174: 403–412.

57. Bajbouj M, Lang UE, Niehaus L, Hellen FE, Heuser I, Neu P (2006):

Влияние правой односторонней электросудорожной терапии на моторную кортикальную возбудимость

у депрессивных пациентов. J Psychiatr Res 40: 322–327.

58. Робол Э., Фиаски А., Манганотти П. (2004): Влияние циталопрама на возбудимость

моторной коры головного мозга человека: исследование парной магнитной стимуляции

. J Neurol Sci 221: 41–46.

Соматостатин-положительный дефицит ГАМК при депрессии

556 Биологическая психиатрия 15 октября 2017 г .; 82: 549–559 www.sobp.org/journal

Биологический

Психиатрия

Вызванное активностью ремоделирование микросхем обонятельной луковицы, выявленное с помощью моносинаптического отслеживания

Цитата: Arenkiel BR, Hasegawa H, Yi JD, Larsen al. (2011) индуцированное активностью ремоделирование микросхем обонятельной луковицы, выявленное с помощью моносинаптического отслеживания. PLoS ONE 6 (12): e29423. https://doi.org/10.1371/journal.pone.0029423

Редактор: Брайан Д.McCabe, Колумбийский университет, Соединенные Штаты Америки

Поступила: 22 июня 2011 г .; Одобрена: 28 ноября 2011 г .; Опубликован: 28 декабря 2011 г.

Авторские права: © 2011 Arenkiel et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Финансирование: Эта работа была поддержана грантом Национального института неврологических расстройств и инсульта R00NS064171 и фондом Макнейра (BRA), грантом Национального института глаз R01EY018323 (BDP), грантами Национального института здравоохранения MH086339, NS04756474 и MH0478. (MDE) и Медицинский институт Говарда Хьюза (MDE).Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: MDE является сотрудником Pfizer, Inc. Это не меняет приверженности авторов всем политикам PLoS ONE в отношении обмена данными и материалами.

Введение

Мозг млекопитающих обеспечивает адаптивное поведение посредством большая емкость по сотовой и схемной пластике. Разнообразные масштабы нейральной пластичности варьируются от модификации одиночного синапса [1] — [3] до ремоделирования сети, которое сопровождает текущий нейрогенез [4] — [7].Механизмы пластичности приспосабливаются к изменяющимся стимулам окружающей среды, которые непрерывно передаются в мозг через множество сенсорных модальностей. Среди сенсорных систем обонятельная система обладает большой способностью к пластичности цепей за счет непрерывной генерации новых нейронов во взрослой жизни. Такое постоянное включение новых нейронов подразумевает стойкое крупномасштабное ремоделирование синаптических связей, природа которого не очень хорошо известна.

Внутри обонятельной системы аксоны обонятельных сенсорных нейронов (OSN), экспрессирующие один и тот же пахучий рецептор [8], сходятся на дискретных клубочках в главной обонятельной луковице (MOB) [9], [10].Организованные вокруг клубочков группы митральных / пучковых клеток, а также различные интернейроны образуют связанные сети, которые распространяются на все слои обонятельной луковицы [11]. Эти сети, вероятно, представляют собой унитарные модули для обработки информации об запахах [11] — [14] и могут быть функционально аналогичны барабанам в соматосенсорной коре или столбцам глазного доминирования в зрительной системе.

Функциональная организация внутри и между клубочковыми единицами MOB была предметом интенсивных исследований.Боковые взаимодействия между клубочками опосредуются в основном дендродендритными синапсами между митральными клетками и гранулированными клетками [15] — [20], и электрофизиологические свойства этих синапсов хорошо изучены [13], [21], [22]. Хотя эти эксперименты в основном изучались как одиночно зарегистрированные нейроны или синаптически связанные пары, эти эксперименты подтверждают мнение о том, что популяции нейронов, связанных с несколькими клубочками, сильно взаимосвязаны. Среди наиболее изученных форм внутрибульбарной схемы гранулярные клетки обеспечивают тормозящую обратную связь с пространственно удаленными клубочками, образуя синапсы с боковыми дендритами митральных клеток [13], [15].Кроме того, синаптические входы как от локальных коротких аксонных клеток (SACs), так и от отдаленных кортикальных нейронов обеспечивают прямую регуляцию синапсов гранулярно-митральных клеток [23] — [26]. Несмотря на центральную роль в обонятельной обработке, относительная связь отдельных гранулярных клеток с разными типами клеток, пространственная организация синаптических партнеров гранулярных клеток и регуляция связности гранулярных клеток с помощью сенсорной стимуляции остаются неясными.

Новые ГАМКергические гранулы и перигломерулярные клетки в MOB постоянно генерируются на протяжении всей взрослой жизни [27] — [29].В то время как многие нейроны, рожденные взрослыми, не способны создавать и поддерживать дендродендритные синапсы и в конечном итоге подвергаются апоптозу [30] — [32], гранулярные клетки, рожденные на ранних стадиях постнатального развития, имеют тенденцию быть долгоживущими и образуют стабильные синаптические связи [33]. Таким образом, мы стремились определить паттерны клеточной связи, сформированной постнатально рожденными гранулированными клетками в MOB, и определить, как новые микросхемы гранулярных клеток находятся под влиянием сенсорного ввода. В настоящем исследовании мы использовали отслеживание моносинаптических цепей с использованием псевдотипированного вируса бешенства вместе с условным репортерным штаммом мышей с красной флуоресценцией для маркировки интернейронов новорожденных обонятельных луковиц и их пресинаптических партнеров in vivo [34].Мы показываем, что постнатальные гранулярные клетки образуют синаптические связи с корковыми входами и несколькими типами клеток обонятельных луковиц. Паттерн моносинаптической связи показывает кластерную организацию, которая характеризуется обширными пресинаптическими входами от анатомически различных коротких аксонных клеток. Более того, усиление сенсорного восприятия за счет обогащения запаха усиливает связь SAC с нейронами гранул, рожденных в постнатальном периоде. Эти результаты определяют пресинаптический репертуар новых входов в новорожденные гранулярные клетки и поддерживают модель, согласно которой кластерные паттерны организации в обонятельной луковице простираются от локальных коротких аксонных клеток до когорт глубоких гранулярных клеток, которые охватывают пластинки обонятельной луковицы.Идентификация многочисленных коротких аксонных клеток, пресинаптических по отношению к новым гранулярным клеткам, выявляет непредвиденные клеточные взаимодействия, которые происходят во время развития синапсов гранулярных клеток (GC). Управляемые опытом изменения в связности SAC-GC обеспечивают основу схемы для уточнения или ремоделирования синаптических входов при воздействии сложной сенсорной среды посредством непрерывного нейрогенеза.

Результаты

Моносинаптическое отслеживание выявляет синаптическую связь с постнатальными гранулированными клетками

Функциональная проводка в обонятельной луковице начинается во время эмбриогенеза и продолжается на протяжении всей постнатальной жизни.В то время как эмбрионально происходящие интернейроны MOB происходят из латерального ганглиозного возвышения и дорсального телэнцефалона [35] — [38], те, которые рождаются постнатально, генерируются исключительно из субвентрикулярной зоны (SVZ) бокового желудочка [39] — [42]. Хотя многое известно о клеточных паттернах развития интернейронов MOB [35], [43], [44], паттерны синаптических соединений с новыми гранулированными клетками изучены плохо. Чтобы определить постнатальные паттерны синаптических связей на новорожденных гранулярных клетках, мы выполнили in vivo моносинаптических цепей трассировки [34].Для этого мы создали условную репортерную мышь, несущую Cre / loxP-зависимый аллель (рис.1a, S1a и S1b), способную управлять высокими уровнями цитозольной экспрессии tdTomato при введении плазмиды G-IRES-TVA-IRES-Cre ( Рис. 1b), который кодирует компоненты для целевой инфекции вируса бешенства (RV), распространения моносинаптического вируса и Cre-опосредованной условной активации репортера. В этой конструкции нейроны генетически нацелены на инфекцию посредством экспрессии рецептора TVA, который селективно связывается с частицами RV, псевдотипированными белками оболочки EnvA [45].Поскольку сконструированный мутант RV лишен белка оболочки G, плазмидная экспрессия белка оболочки бешенства G дикого типа делает возможным ровно один раунд «живой» упаковки вируса и транс-синаптической инфекции пресинаптических клеток [34], [46] — [50] . Ретроградное распространение вируса является строго моносинаптическим, поскольку только клетки, которые получают G-IRES-TVA-IRES-Cre, способны синтезировать живой вирус, тогда как пресинаптические мишени не содержат G-белок и, следовательно, неспособны продуцировать инфекционные частицы RV. Замена вирусного гена, кодирующего белок капсида G, репортером EGFP делает пресинаптические партнеры клеток-мишеней RV ярко помеченными [34], [51].

Рис. 1. Разработанный вирус бешенства позволяет отслеживать моносинаптические цепи в обонятельной луковице.

(a) Иллюстрация условного детонационного аллеля ROSA26-stop flox -tdTomato . (b) Иллюстрация трицистронной экспрессионной конструкции G-IRES-TVA-IRES-Cre, используемой для электропорации в субвентрикулярную зону (SVZ) мышей ROSA26-stop flox -tdTomato . (c) Иллюстрация процедуры электропорации in vivo . Слева плазмидную ДНК, кодирующую G-IRES-TVA-IRES-Cre, инъецировали в боковой желудочек новорожденных мышей.В центре на голову подавали прямоугольное импульсное напряжение для введения экспрессионной конструкции в предшественники SVZ. Справа, через 30 дней после электропорации, псевдотипированный SADΔG-EGFP RV вводили в обонятельную луковицу для направленной инфекции электропорированных гранулярных клеток. (d) Диаграмма, показывающая, как пре- и постсинаптические нейроны могут быть идентифицированы с помощью двухцветного моносинаптического вирусного отслеживания на условном фоне ROSA26-stop flox -tdTomato . Красные клетки представляют собой условную экспрессию репортера tdTomato после электропорации G-IRES-TVA-IRES-Cre.Желтые клетки представляют собой электропорированные клетки, которые также инфицированы SADΔG-EGFP RV. Зеленые клетки представляют собой пресинаптические мишени инфицированных гранулярных клеток. GL — гломерулярный слой; ЭПЛ, внешний плексиформный слой; ML, слой митральных клеток; IPL, внутренний плексиформный слой; GCL, гранулированный клеточный слой. (e) Схема, иллюстрирующая предполагаемый домен инфекции SADΔG-EGFP RV по отношению ко всей луковице. В среднем инфицированные гранулярные клетки выявлялись в пределах 302 мкм от места инъекции (зеленый кружок) ± 214 мкм (желтый внешний кружок).Масштабная линейка 300 мкм. (f) Общий вид мозга мыши ROSA26-stop flox -tdTomato через 30 дней после односторонней электропорации G-IRES-TVA-IRES-Cre. Пунктирная линия представляет корональный разрез, изображенный на (g) — (i). OB, обонятельная луковица. Шкала шкалы 1 мм. (g) Корональный срез через электропорированную и инфицированную обонятельную луковицу, показывающий экспрессию tdTomato и SADΔG-EGFP. Масштабная линейка 300 мкм. (h) Корональный срез обонятельной луковицы электропорированных мышей, показывающий гранулярные клетки, экспрессирующие tdTomato, при большем увеличении.(i) Раздел, показанный в (h), отображен для SADΔG-EGFP после инфицирования RV. (j) Объединенный вид (h) и (i). MC, митральная клетка; GC — гранулярно-клеточное происхождение; пунктирная стрелка — дендрит гранулярных клеток. Масштабная линейка 25 мкм. (k) — (m) Двойная экспрессия репортера tdTomato плюс SADΔG-EGFP, идентифицирующая микросхему локальной гранулярной клетки. (k) экспрессия tdTomato в отдельной гранулярной клетке. (l) экспрессия SADΔG-EGFP в той же «исходной» гранулярной клетке, показанной на (k), и локальных пресинаптических партнерах. (m) Объединенная репортерная экспрессия, очерчивающая исходную клетку (желтый) и локальных пресинаптических партнеров (зеленый).Короткие стрелки в (k – m) указывают на исходную гранулярную ячейку. Масштабная линейка 10 мкм.

https://doi.org/10.1371/journal.pone.0029423.g001

Чтобы проверить функциональность нашей системы отслеживания, мы ввели трицистронную конструкцию G-IRES-TVA-IRES-Cre в боковые желудочки эмбрионального день 14.5 (E14.5) ROSA26-stop flox -tdTomato , электропорировали нейрональные предшественники в зоне желудочка и сделали ex vivo культур кортикальных срезов [52] (рис.S1c – i). Через два дня EnvA-псевдотипированные частицы SADΔG-EGFP RV [34] наносили на культивированные срезы мозга для заражения нейронов, экспрессирующих G-IRES-TVA-IRES-Cre. Три дня спустя мы наблюдали широко распространенную экспрессию tdTomato во всех слоях 4 и 5 и в стенках желудочков (рис. S1c, S1f и S1i), что указывает на нейроны, экспрессирующие рекомбиназу Cre через кассету G-IRES-TVA-IRES-Cre. Кроме того, мы наблюдали экспрессию EGFP в небольшом количестве tdTomato-позитивных нейронов, непосредственно инфицированных SADΔG-EGFP RV, которые выглядели желтыми (рис.S1h и S1i). Наконец, мы наблюдали большую когорту EGFP-экспрессирующих нейронов, лишенных экспрессии tdTomato, показывая транс-синаптическое распространение SADΔG-EGFP RV к пресинаптическим партнерам RV-инфицированных клеток (Figs. S1g-i).

Убедившись, что наша трицистронная конструкция против бешенства G-IRES-TVA-IRES-Cre (рис. 1b) функционирует вместе с линией мышей ROSA26-stop flox -tdTomato (рис. 1a), мы реализовали эту модельную систему. изучить синаптические связи, сформированные на постнатальных гранулярных клетках в обонятельной луковице.Чтобы нацелить новорожденные гранулярные клетки на инфекцию ПЖ и последующее моносинаптическое отслеживание, мы ввели конструкцию G-IRES-TVA-IRES-Cre в SVZ мышей постнатального дня 2 (P2) и приложили внешнее напряжение к мозгу для электропорации предшественников нейронов ( Рис. 1в, слева) [53]. Через 30 дней, когда многие из электропорированных клеток мигрировали в MOB и образовали функциональные синаптические связи [44], [54], EnvA-псевдотипированный SADΔG-EGFP вирус бешенства был введен в слой гранулированных клеток обонятельной луковицы для инфицировать новообразованные нейроны, экспрессирующие G-IRES-TVA-IRES-Cre (рис.1в, справа). Эта экспериментальная парадигма позволила нам исследовать моносинаптическую связь на постнатальных гранулярных клетках путем прямой визуализации жизненной флуоресценции нейронов, восприимчивых к псевдотипированной инфекции RV (красный), тех, которые стали инфицированными (красный и зеленый, следовательно, желтый), и пресинаптических нейронов-мишеней ( зеленый) (рис. 1г). Чтобы нацелить электропорированные гранулярные клетки для инфекции и моносинаптического отслеживания, мы вводили 250 мкл вируса бешенства SADΔG-EGFP на 750 мкм ниже поверхности обонятельной луковицы, на полпути от передней и задней границ.Хотя методы электропорации in vivo и вирусной инфекции варьируются, путем подсчета количества инфицированных исходных клеток и определения среднего бульбарного объема, охватываемого этими клетками, мы оценили распространение вируса и инфекцию, чтобы охватить сферический домен размером 300 ± 200 мкм в диаметр (рис. 1д, n = 10 меченых луковиц от 10 мышей). Для подсчета меченых исходных клеток мы сделали 100 мкм срезы через всю луковицу и идентифицировали все GC, которые экспрессировали как EGFP, так и tdTomato (n = 20-25 срезов каждый, при этом средние 3-5 срезов содержат большую часть меченых клеток).Иногда мы инфицировали перигломерулярные клетки, которые также постоянно генерируются из электропорированных SVZ [43]. В этих случаях мы наблюдали маркировку типов клеток, которые вносят вклад в сферические структуры клубочков (данные не показаны). Чтобы избежать заражения новорожденных перигломерулярных клеток, мы добавили небольшой объем (~ 20 нл) минерального масла в кончик инъекционной пипетки, чтобы предотвратить воздействие вируса при прохождении через поверхностные слои луковиц на пути к слою гранулярных клеток.

Через неделю после инфицирования RV мы обработали обонятельную луковицу и визуализировали фиксированные срезы для экспрессии репортера.Подобно тому, что мы наблюдали в эксплантатах кортикальных срезов (Fig. S1c – i), in vivo, условная активация репортера и транс-синаптическое вирусное мечение были устойчивыми и демонстрировали различные паттерны пресинаптического мечения (Figs. 1f-m). Хотя мы начали наблюдать вирус-опосредованный EGFP в пресинаптических клетках-мишенях через 3 дня после инфицирования, высокие и стабильные уровни мечения обычно достигаются через 7 дней. К 14 дню после инфицирования многочисленные пресинаптические нейроны показали аномальную морфологию, вероятно, из-за чрезвычайно высоких уровней репортерной экспрессии, управляемых геномом RV.Таким образом, для всех последующих экспериментов мы выбрали 7 дней после заражения, чтобы исследовать нашу пресинаптическую маркировку. Поскольку электропорация основана на генерации напряжения в пространстве желудочков, введенная ДНК воспроизводимо показывала односторонние паттерны экспрессии репортера в головном мозге (рис. 1f). Этот феномен был наиболее очевиден при визуализации условной экспрессии tdTomato после временного введения Cre в SVZ, которое запускало экспрессию tdTomato в нейрональных предшественниках, которые оставались активными во всех дочерних клетках, рожденных от электропорированного клона (рис.1г и 1ч). Хотя этот подход привел к клональному мечению многих новорожденных гранулярных клеток tdTomato, мы смогли выявить небольшое количество постнатальных гранулярных клеток для SADΔG-EGFP RV-инфекции (рис. 1i и 1j). Этот подход позволил нам разделить отдельные кластеры пресинаптических мишеней на электропорированные гранулярные клетки (Fig. 1k – m). На основании редкой инфекции SADΔG-EGFP RV, отсутствия точек заражения в непосредственной близости друг от друга и отсутствия клональных секторов (в отличие от тех, которые наблюдаются в кортикальных срезах, рис.S1), мы пришли к выводу, что только очень небольшое количество электропорированных клеток продемонстрировало стабильную интеграцию электропорированной плазмиды G-IRES-TVA-IRES-Cre. Чтобы дополнительно проверить это, мы выполнили моносинаптическое мечение постнатально рожденных сетей гранулярных клеток, маркируя нейрональные клоны, рожденные после электропорации с бромдезоксиуридином (BrdU) (рис. S2a). Через 14 дней после электропорации мышам добавляли BrdU в питьевую воду в течение 2 недель для маркировки всех нейронов, родившихся после этого времени, с последующей инфекцией RV и последующей обработкой тканей.Сравнивая количество зеленых пресинаптических входов с количеством зеленых клеток, меченных BrdU, мы редко когда-либо наблюдали новорожденные нейроны, которые были дважды помечены (Fig. S2b-e). Эти данные показывают, что только очень небольшая часть клеток, меченных tdTomato, несут компоненты моносинаптического отслеживания, и предполагают, что стабильная интеграция нашей экспрессионной плазмиды является редкой и, вероятно, происходит в постмитотических нейрональных предшественниках. Путем отдельной маркировки первичных точек инфекции (желтые исходные клетки) и когорты нейронов, обеспечивающих пресинаптический вход (зеленый цвет) (рис.1d), эта модульная молекулярно-генетическая система на основе вирусов, таким образом, позволила нам напрямую визуализировать синаптические микросхемы, связанные с постнатальными гранулированными клетками.

Когорты митральных клеток и синапсов коротких аксонных клеток на новые гранулярные клетки

Полный набор нейронов, которые контактируют с недавно интегрированными гранулярными клетками, неизвестен. В дополнение к дендродендритным синапсам, образованным между митральными / пучковыми клетками и гранулярными клетками, недавно было показано, что гранулярные клетки образуют функциональные связи с множественными типами локальных интернейронных клеток [24], [26].После генетического воздействия на постнатальные гранулярные клетки для инфекции SADΔG-EGFP RV, мы наблюдали обширное мечение во всей гранулярной клетке, митральной клетке и внешних плексиформных слоях (EPL) в нейронах, пресинаптических к электропорированным гранулярным клеткам. Интересно, что мы отметили сгруппированные модели связи (рис. 2а). Эти сгруппированные сети содержали митральные клетки [55] (рис. 2b) и другие клетки инфрамитрального слоя, которые морфологически соответствовали поверхностным и глубоким коротким аксонным клеткам (SAC) (рис.2в и 2г). Ограничивая экспрессию G, TVA и Cre бешенства постнатально рожденными интернейронами посредством рассчитанной по времени in vivo электропорации, мы никогда не наблюдали условную экспрессию репортера tdTomato в типах клеток, кроме перигломерулярных и гранулярных клеток. Кроме того, мы никогда не наблюдали транс-синаптического мечения между гранулированными клетками, рожденными после электропорации (рис. S2 и данные не показаны), что является аргументом против неспецифического поглощения RV посредством побочного эффекта близости.

Рисунок 2. SADΔG-EGFP RV ретроградно транспортируется от гранулярных клеток к пресинаптическим мишеням в обонятельной луковице.

(a) Коронковый срез обонятельной луковицы после моносинаптического отслеживания вируса, демонстрирующий кластерный паттерн пресинаптического мечения. Пунктирная линия показывает среднюю линию коронарного сечения MOB. Масштабная линейка, 100 мкм. (б) Экспрессия SADΔG-EGFP в пресинаптических митральных клетках. Масштабная линейка 25 мкм. (c) — (d) Экспрессия SADΔG-EGFP в коротких аксонных клетках во внешних слоях плексиформных и гранулярных клеток (заштрихованные желтые прямоугольники). Масштабные линейки, 20 мкм. (e) — (g) Частичное мечение кальретинина в клетках, экспрессирующих SADΔG-EGFP.Масштабная линейка, 20 мкм. (h) — (j) Частичное мечение парвальбумина в клетках, экспрессирующих SADΔG-EGFP. Масштабная линейка, 20 мкм. (k) — (m) Перекрывающаяся экспрессия GABA A R α1 в коротких аксонных клетках, меченных SADΔG-EGFP. Масштабная линейка 15 мкм. (n) — (p) клетки, экспрессирующие SADΔG-EGFP, не экспрессируют тирозингидроксилазу и, следовательно, не являются перигломерулярными. Пунктирные стрелки указывают на положительную по тирозингидроксилазе клетку, не меченную SADΔG-EGFP RV. Масштабная линейка, 20 мкм. (q) — (s) Экспрессия GFAP в случайных глиальных клетках, меченных SADΔG-EGFP.Масштабная линейка 10 мкм. Стрелки указывают на перекрывающуюся экспрессию маркеров в клетках, меченных SADΔG-EGFP. Для всех панелей GL, гломерулярный слой; ЭПЛ, внешний плексиформный слой; ML, слой митральных клеток; GCL, гранулированный клеточный слой.

https://doi.org/10.1371/journal.pone.0029423.g002

Варьирование количества псевдотипированного RV, введенного в MOB, позволило нам контролировать количество инфицированных вирусами исходных клеток. Уровни вирусной инфекции варьировались от очень низкого (100 нл) (рис. 1к – м) до высокого (500 нл) (рис.2а) и, таким образом, может быть настроен для оптимального анализа микросхем. Для наших экспериментов мы использовали условия (250 нл), которые достигли умеренного уровня мечения (см. Рис. 1e и экспериментальные процедуры), чтобы облегчить идентификацию исходных клеток и пресинаптических партнеров. Чтобы подтвердить ретроградный транс-синаптический транспорт SADΔG-EGFP RV, мы исследовали экспрессию EGFP в областях коры головного мозга, которые, как известно, посылают центробежные сигналы дальнего действия в MOB и создают синапсы на гранулярных клетках [13], [56]. В соответствии с известным пресинаптическим транспортом RV, мы наблюдали сильную экспрессию SADΔG-EGFP в нейронах переднего обонятельного ядра (AON), горизонтальной конечности ядра диагональной полосы (HDB) и грушевидной коры (рис.S3). Более того, полное отсутствие метки EGFP в обонятельных сенсорных нейронах (OSN), которые сильно иннервируют MOB и синапс на митральные клетки, подтвердило, что мечение вируса прекращается после одного пресинаптического соединения (данные не показаны). Вместе эти данные показывают, что постнатальные гранулярные клетки могут быть точно нацелены на инфекцию RV, демонстрируют как короткие, так и дальние синаптические связи с постнатальными гранулярными клетками и выявляют кластерные паттерны организации, присущие микросхемам гранулярных клеток.

Для дальнейшего изучения репертуара клеток, пресинаптических по отношению к постнатальным гранулярным клеткам, мы выполнили иммуногистохимический анализ тонких срезов MOB и подсчитали количество EGFP-положительных, инфицированных RV нейронов, которые были отрицательными для tdTomato (следовательно, пресинаптических к Cre-экспрессирующим гранулярные клетки) с использованием молекулярных маркеров, экспрессируемых типами клеток обонятельной луковицы [57]. Чтобы начать выяснение молекулярной идентичности клеток, пресинаптических по отношению к новорожденным гранулярным клеткам, мы сделали 50 мкм срезы через меченый домен MOB (в среднем 6 срезов на луковицу), провели иммуногистохимию и подсчитали клетки, меченные EGFP, чтобы определить процент клеток это показало перекрывающуюся экспрессию различных маркеров интернейронов.В то время как только часть EGFP-положительных клеток экспрессировала маркеры интернейронов кальретинин (46 ± 5% EGFP-положительных клеток, n = 100 клеток в 18 срезах от 4 мышей; рис. 2e – g) и парвальбумин (55 ± 7%; рис. 2h – j), мы обычно наблюдали коэкспрессию субъединицы α1 рецептора GABA A (84 ± 4%; рис. 2k – m), которая высоко и избирательно экспрессируется в SAC, находящихся в инфрамитральных слоях клеток [57]. . Таким образом, посредством иммуногистохимического анализа маркеров интернейронов в обонятельной луковице, ~ 50% клеток, меченных SADΔG-EGFP, экспрессировали парвальбумин и / или кальретинин, тогда как> 80% локальных пресинаптических входов экспрессировали субъединицу рецептора GABA A α1.Мы никогда не обнаружили экспрессию SADΔG-EGFP в типах клеток, которые экспрессируют тирозингидроксилазу в верхнем EPL или слое клубочковых клеток (Figs. 2n-p). Интересно, что время от времени мы наблюдали экспрессию SADΔG-EGFP в ближайших глиальных клетках, которые напрямую контактировали с дендритами исходных гранулярных клеток (GC), как показано совместной локализацией с глиальным фибриллярным кислым белком (GFAP) (рис. 2q – s), что указывает на потенциальную роль для глиальный контакт при ремоделировании синапсов новорожденных гранулярных клеток [58] — [60]. Вместе эти данные показывают, что помимо формирования хорошо описанных контактов с центробежными входами и дендродендритными синапсами с митральными и тафтинговыми клетками, постнатальные гранулярные клетки получают обширный вход от локальных SAC в MOB.

Чтобы более внимательно изучить связь между гранулированными клетками и их пресинаптическими партнерами, мы воспользовались схемой двухцветной маркировки нашей экспериментальной системы, чтобы подсчитать количество и типы нейронов, которые были помечены SADΔG-EGFP RV путем моносинаптического переноса. Учитывая, что все гранулярные клетки, нацеленные на электропорацию G-IRES-TVA-IRES-Cre, экспрессируют tdTomato (красный), и только часть этих клеток заразилась введенным SADΔG-EGFP RV (красный и зеленый, следовательно, желтый), пресинаптические мишени могут четко идентифицироваться по наличию только EGFP (зеленый) (рис.1г). Из наших иммуногистохимических данных, идентифицирующих большинство пресинаптических нейронов немитральных клеток как SACs (рис. 2c и 2d), мы стремились определить относительную связь SAC с новыми гранулированными клетками. Мы подсчитали дважды помеченные (желтые) гранулы-источники клеток и все их зеленые пресинаптические нейрональные партнеры в серийных срезах целых обонятельных луковиц толщиной 100 мкм. В среднем мы идентифицировали 33 ± 8,1 дважды меченых исходных клеток на луковицу. Интересно, что мы обнаружили, что соотношение пресинаптически меченных коротких аксонных клеток к RV-инфицированным гранулярным клеткам было довольно высоким (4.6 ± 0,8, SEM, n = 7 обонятельных луковиц), что свидетельствует о недооцененном ранее уровне локального поступления САК в гранулярные клетки новорожденного.

Затем мы исследовали кластерную архитектуру пресинаптических SAC для недавно интегрированных GC. Для этого мы выбрали ткань обонятельной луковицы, которая имела относительно редкую инфекцию SADΔG-EGFP RV и пресинаптическую метку, чтобы облегчить визуализацию меченых SAC в микросхемах GC с клеточным разрешением (рис. 3a-c). Чтобы определить относительное количество, расположение и типы пресинаптических нейронов, которые вносят вклад в кластеризованную сеть, мы подготовили полутолстые срезы мозга (150–200 мкм), которые были оптически очищены в глицерине для конфокальной визуализации z-стека и трехмерного объема. рендеринг [61].Чтобы количественно оценить входы в исходные клетки гранул, мы взяли последовательные плоскости изображения через срезы с интервалом 2 мкм, подсчитав все нейроны с двойной меткой и только зеленые нейроны, чтобы определить отношение пресинаптических входов к исходным клеткам гранул. В дополнение к четко идентифицируемым митральным клеткам (Fig. 2a-d), реконструированные стопки изображений выявили две основные популяции SAC, которые ранее были охарактеризованы как глубокие SAC и поверхностные SAC [24], [57], [62]. Количественный анализ выявил 5,6 ± 1,5 SAC на разрешаемую кластерную сеть (рис.3d), а средняя ширина сети (включая тела клеток SAC и проксимальные дендриты) составляет 148,5 ± 40,6 мкм (n = 10 сетей SAC / GC из 4 луковиц, из 4 мышей ± SEM). Пресинаптические нейроны к отдельным GC были классифицированы как SAC по морфологии, анализу молекулярных маркеров и электрофизиологическим свойствам (рис. 2 и рис. 3d-f), тогда как ширина сетей GC-SAC была определена путем измерения длины четко разрешимых SAC. дендриты. В соответствии с предыдущими сообщениями [24], [63], пресинаптические глубокие SAC показали низкочастотные последовательности потенциалов действия с инъекциями деполяризующего тока, тогда как поверхностные SAC отвечали высокочастотными паттернами возбуждения (рис.3д – е). Маловероятно, что наша вирусная маркировка идентифицирует полный набор функциональных синапсов на постнатальных гранулярных клетках из-за неизвестной эффективности переноса частиц. Кроме того, вполне вероятно, что мы недооценили ширину функционального кластера MOB, не включив дистальные ветви аксонов SAC в нашу характеристику из-за отсутствия изображений с высоким разрешением в толстых срезах мозга. В целом эти данные обнаруживают неожиданную и обширную локальную связь между SACs и недавно интегрированными гранулированными клетками в обонятельной луковице.

Рис. 3. Гранулярные клетки новорожденного получают обширный вход от коротких аксонных клеток.

(a) — (c) Микросхема обонятельной луковицы, меченная SADΔG-EGFP, в которой пре- и постсинаптические типы клеток могут быть идентифицированы с помощью дифференциальной репортерной экспрессии. Электропорированные клетки выглядят красными из-за активации Cre экспрессии tdTomato. Клетки-источники, инфицированные SADΔG-EGFP, выглядят желтыми из-за совместной экспрессии tdTomato и EGFP. Пресинаптические партнеры становятся транссинаптически инфицированными SADΔG-EGFP, но лишены Cre и, таким образом, выглядят зелеными.Пунктирная стрелка указывает на митральную клетку MC. Стрелки указывают на короткие аксонные клетки, мешки. Стрелки указывают на исходную гранулярную ячейку, GC. Для (a) — (d): EPL, внешний плексиформный слой; ML, слой митральных клеток; GCL, гранулированный клеточный слой. (а) Экспрессия tdTomato (красный) в рекомбинированных Cre-экспрессирующих гранулярных клетках. (b) Экспрессия SADΔG-EGFP в клетке-источнике гранулы (стрелка) и ее пресинаптических мишенях (стрелки). (c) Объединение пунктов (a) и (b). Масштабная линейка, 20 мкм. (d) Примеры реконструкций с объемной визуализацией, показывающие локальные микросхемы коротких аксонных клеток с синаптическими контактами с гранулярными клетками новорожденного.Клетки постсинаптических гранул показаны красным цветом, а клетки пресинаптического короткого аксона показаны зеленым. Масштабная линейка 15 мкм. (e) — (f) Примеры реакций потенциала действия на инъекцию деполяризующего тока и изображения типов коротких аксонных клеток, которые, как наблюдали, устанавливают синаптические контакты с новорожденными гранулярными клетками. Показаны ответные реакции (слева) и клеточная морфология (справа) типичной клетки с глубоким коротким аксоном (e) и клетки с поверхностным коротким аксоном (f) с контактами с новорожденной гранулярной клеткой. Масштабные линейки 15 и 10 мкм соответственно.

https://doi.org/10.1371/journal.pone.0029423.g003

Обогащение запаха увеличивает возможность подключения SAC-GC в обонятельной лампе

Чтобы изучить, как сенсорный опыт влияет на микросхемы гранулярных клеток, мы проанализировали паттерны связи между гранулированными клетками и их пресинаптическими целями после обонятельной стимуляции. Мы сконцентрировались на синаптическом входе от SAC, поскольку эти клетки были надежно помечены с использованием моносинаптического отслеживания RV (рис. 2, 3).Чтобы обеспечить широкую палитру запахов для долгосрочного сенсорного обогащения, мы разработали роботизированную систему для непрерывной циклической доставки нескольких одорантов свободно исследующим мышам (см. Рис. S4 и методы). Для обогащения запаха мышей ROSA26-stop flox -tdTomato подвергали in vivo SVZ электропорации с G-IRES-TVA-IRES-Cre и выращивали со своими матерями в течение 30 дней в клетках, портированных для доставки запаха (рис. . S4). После 30-дневного периода стимуляции запаха SADΔG-EGFP RV вводили в слой гранулярных клеток обонятельной луковицы, а через 7 дней обонятельную луковицу рассекали и делали срезы для подсчета двухкомпонентных (желтых) гранулярных клеток и их однокомпонентных клеток. (зеленый) пресинаптические партнеры (рис.4а). Воздействие запаха вызывало резкое увеличение количества SAC, пресинаптически связанных с новыми гранулированными клетками, по сравнению с контрольной группой, не обогащенной запахом (фиг. 4b и 4c). В частности, стимуляция запаха утроила коэффициент связи SAC с исходными GC (контроль, 4,6 ± 0,8; обогащенный запахом, 13,8 ± 1,0; n = 3 луковицы от 3 мышей, ± SEM) (рис. 4d). В среднем мы насчитали 48 ± 14 клеток-источников с двойной меткой на одну луковицу у мышей, подвергнутых обогащению запахом. Увеличение количества меченых пресинаптических партнеров не было просто отражением увеличения абсолютного количества новых гранулярных клеток, поскольку количественная оценка нормализуется к количеству меченых гранулярных клеток.Таким образом, обогащение запаха усиливает связь SAC с новыми гранулированными клетками.

Рис. 4. Обогащение запаха увеличивает связь SAC с гранулированными ячейками.

(а) Схема экспериментальной парадигмы для отслеживания изменений в связности гранулярных клеток после обогащения запаха. (b) Область контрольной обонятельной луковицы с двойной меткой, показывающая экспрессию SADΔG-EGFP в пресинаптических мишенях. Масштабная линейка 10 мкм. (c) Обонятельная луковица с двойной меткой от мыши, подвергнутой обогащению запахом, показывающая усиление пресинаптической метки (зеленый).Стрелки указывают на исходные гранулярные клетки (GC), которые выглядят желтыми из-за совместной экспрессии tdTomato и EGFP. Пресинаптические партнеры отображаются зеленым цветом. Масштабная линейка 10 мкм. ЭПЛ, внешний плексиформный слой; ML, слой митральных клеток; GCL, гранулированный клеточный слой. (d) Коэффициент связности между постсинаптическими гранулярными клетками и пресинаптическими клетками короткого аксона (SAC∶GC) в контрольных условиях или после обогащения запаха. * p <0,01, t-критерий Стьюдента.

https://doi.org/10.1371/journal.pone.0029423.g004

Одно из возможных объяснений увеличения мечения пресинаптических клеток при стимуляции запаха состоит в том, что повышенная активность нейронов усиливает перенос ПЖ в существующих синапсах. Чтобы решить эту проблему, мы приготовили эксплантаты обонятельной луковицы от мышей, которым была подвергнута электропорация плазмидой, кодирующей компоненты моносинаптического отслеживания, инфицированных SADΔG-EGFP RV и культивированных в присутствии фармакологических агентов для блокирования синаптической передачи. Мы обнаружили, что блокирование SNARE-зависимого высвобождения нейротрансмиттера, потенциалов действия или быстрой глутаматергической нейротрансмиссии не оказало значительного влияния на количество моносинаптически меченых клеток по сравнению с необработанными контролями (рис.S5). Таким образом, транс-синаптический перенос RV нечувствителен к манипуляциям с активностью в течение нескольких дней in vitro , и мы заключаем, что вызванное запахом расширение в цепи гранулярных клеток, маркирующих in vivo (рис. 4c и 4d), связано с изменениями. в количестве синаптических входов на гранулярную клетку, а не в изменении эффективности передачи правого желудочка между нейронами после обонятельной стимуляции. В соответствии с этим представлением мы наблюдали морфологические различия самих гранулярных клеток.Дважды меченые гранулярные клетки-источники в луковицах мышей, выращенных в среде с обогащенным запахом, показали значительное увеличение количества дендритных выступов (контроль, 8,4 ± 0,7 на дендрит 25 мкм, n = 17 нейронов с двойной меткой от 3 мышей; запах, 12,7 ± 0,9; n = 18 нейронов с двойной меткой от 4 мышей; p <0,01; рис. 5а и 5б). Мы также отметили значительное увеличение количества тормозных синапсов на дендритах исходных гранулярных клеток при окрашивании на ингибиторный маркер синапсов гефирин (контроль, 7.8 ± 0,9 кластеров гефирина на дендрит 35 мкм; запах 11,9 ± 1,3; n = 12 нейронов из 3 луковиц каждый; р <0,02; Рис. 5c и 5d). Чтобы ограничить наш анализ синаптическими изменениями в постнатальных нейронах, гефирин-положительные точки были подсчитаны только в том случае, если они могли быть четко колокализованы в дважды меченых клетках-источниках гранул. В соответствии с усилением входа SAC в гранулярные клетки после обогащения запаха, мы также отметили увеличение входа митральных клеток (данные не показаны). Принимая во внимание эти данные, мы не можем исключить, что часть гефирин-положительных точек действительно может соответствовать повышенному центробежному входу от других ингибирующих типов клеток.Тем не менее, эти данные подтверждают усиление пресинаптического воздействия на новорожденные нейроны после обогащения запаха и показывают индуцированное активностью расширение цепей SAC.

Рис. 5. Стимуляция запаха увеличивает синаптические входы в гранулярные клетки новорожденного.

(a) Дендриты гранулярных клеток у контрольных мышей или мышей, подвергшихся воздействию запаха, демонстрируют увеличенное количество шипов после обогащения запаха. Желтые стрелки указывают на отдельные шипы. Масштабная линейка 3 мкм. (b) Данные представляют собой средние значения ± SEM числа шипов на дендрит 25 мкм на гранулярных клетках у мышей, подвергшихся циклическому воздействию одорантов (запаха), по сравнению с контрольными животными, не подвергавшимися воздействию запаха. * p <0,001, t-критерий Стьюдента. (c) Мечение гефирином для выявления ингибирующих ГАМКергических синапсов на дендритах контрольных гранулярных клеток. Вставки в (c) и (d) показывают экспрессию tdTomato в дважды меченых дендритах. Масштабные линейки, 2 мкм. (d) Увеличение количества меченных гефирином ингибирующих синапсов, контактирующих с дендритами гранулярных клеток мышей, подвергшихся обогащению запахом.

https://doi.org/10.1371/journal.pone.0029423.g005

SACs обеспечивают ГАМКергический ингибирующий вход в гранулярные клетки MOB [24], [26], [64].Затем мы проверили, соответствует ли индуцированное запахом увеличение как пресинаптических по отношению к GC SAC, меченных RV, так и ингибирующих синапсов, меченных гефирином, с изменениями в функциональной синаптической связности. С этой целью мы выполнили регистрацию патч-кламп целых клеток в острых срезах мозга из меченых гранулярных клеток MOB после постнатальной электропорации in vivo и и измерили миниатюрные тормозные постсинаптические токи (mIPSCs). В соответствии с наблюдаемым увеличением количества гефириновых точек (рис.5c, d), стимуляция запаха значительно увеличивала частоту mIPSC в постнатальных гранулярных клетках (рис. 6). В то время как амплитуды mIPSC были одинаковыми между экспериментальными группами (контроль, 15,2 ± 1,4 пА; запах, 14,4 ± 1,3 пА; рис. 6b), частота mIPSC была увеличена у животных, подвергшихся воздействию запаха (контроль, 0,55 ± 0,06 Гц, n = 9 клеток из 3 мыши; запах 0,89 Гц ± 0,07, n = 10 клеток от 4 мышей, p <0,01, непарный t-критерий; рис. 6a). Взятые вместе, эти данные показывают, что сенсорный опыт расширяет связь между короткими аксонными клетками и новыми гранулярными клетками, определяя новый тип клеток реорганизации обонятельных цепей в ответ на активность, индуцированную запахом.

Рис. 6. Обогащение запаха увеличивает ингибирующее действие на гранулярные клетки новорожденного.

(a) — (b) Количественный анализ (a) средней частоты и (b) амплитуды mIPSC, записанных из меченых гранулярных клеток у контрольных мышей и мышей с обогащенным запахом. Обогащение запаха увеличивало частоту, но не амплитуду миПСК гранулярных клеток (контроль, n = 9; запах, n = 10, * p <0,01, непарный t-критерий). (c) Репрезентативные записи с фиксацией напряжения mIPSC из гранулярных клеток в срезах острой MOB от контрольных мышей и мышей с обогащенным запахом.

https://doi.org/10.1371/journal.pone.0029423.g006

Обсуждение

В настоящем исследовании мы объединили отслеживание генетических цепей и технологии мечения in vivo для картирования моносинаптических связей между постнатальными гранулярными клетками и их пресинаптическими входными нейронами в обонятельной луковице мыши. Мы обнаружили, что в дополнение к ранее известным связям с митральными / тафтинговыми клетками, постнатальные гранулярные клетки обнаруживают обширную связь с короткими аксонными клетками, и эти входы коротких аксонных клеток вносят вклад в кластерную архитектуру в обонятельной луковице.Кроме того, мы обнаружили, что усиление сенсорного восприятия в форме стимуляции запаха расширяет возможности связи цепей с гранулярными клетками новорожденного. Это увеличение синаптической связности проявляется как трехкратное расширение пресинаптически связанных коротких аксонных клеток и сопровождается соответствующим увеличением ингибирующих синапсов гранулярных клеток и mIPSCs, а также изменениями в морфологии дендритов.

Ввод коротких аксонных клеток в клетки-гранулы

Реализуя высокоселективную стратегию генетического нацеливания in vivo на , мы исследовали синаптические паттерны связи, которые создаются между постнатальными гранулярными клетками и их пресинаптическими мишенями, используя сконструированный вирус бешенства для отслеживания моносинаптических цепей.Наш экспериментальный план позволил нам выборочно нацелить гранулярные клетки на инфекцию и распространение бешенства с помощью электропорации in vivo [53], что позволяет напрямую определять типы клеток, пресинаптических для нацеленных на гранулярные клетки. Используя этот подход, мы наблюдали дискретные синаптические сети, связанные с микросхемами гранулярных клеток. Удивительно, но большинство нейронов, осуществляющих локальные пресинаптические входы в постнатальные гранулярные клетки, были идентифицированы как SAC в гранулярных клетках и внешних плексиформных слоях обонятельной луковицы.

Недавние морфологические и электрофизиологические исследования показали, что SACs продуцируют ветвления аксонов во всех слоях обонятельной луковицы, являются пресинаптическими по отношению к резидентным гранулярным клеткам и обеспечивают GABAergic вход, который модулирует запуск гранулярных клеток [24], [26], [57]. Интересно, что поверхностные SAC, которые мы идентифицировали в этом исследовании, обладают морфологическими и электрофизиологическими характеристиками, аналогичными нейронам Ван-Гехухтена, которые экспрессируют многие из тех же молекулярных маркеров, что и глубокие SAC, но, как полагают, устанавливают контакты как с GC, так и с митральными клетками и являются аксонами. без [62] — [66].Эти свойства предполагают, что SAC обеспечивают пространственное уточнение локальных тормозных цепей, которые формируют активирующие свойства митральных клеток. В других областях мозга ГАМКергический ввод во время развития нейронов способствует дифференцировке клеток, выживанию и созреванию контуров [67] — [71]. Учитывая продолжающийся взрослый нейрогенез, резидентные клетки короткого аксона в зрелой обонятельной луковице могут сходным образом вносить вклад в динамическое ремоделирование, дифференцировку или выживание вновь включенных гранулярных клеток [43], [72].Таким образом, помимо обеспечения ингибирующего контроля над дендродендритными синапсами в зрелом контуре, SAC могут регулировать синаптическую интеграцию новорожденных гранулярных клеток посредством сигнальных механизмов развития. В таком сценарии обогащение запаха не только изменит сетевую активность в лампочке, но и будет способствовать поступлению ГАМК-энергии в новые GC из выбранных когорт SAC. Эти сети запахов могут служить центрами активности, которые более благоприятны или привлекательны для формирования и выживания синапсов новорожденных нейронов.Более усовершенствованные способы манипуляции активностью контуров с использованием специфических для типов клеток химических, генетических или оптогенетических манипуляций потребуются для полного рассмотрения этого понятия [46].

Наш экспериментальный подход оказался эффективным в разграничении типов пресинаптических клеток, которые, как известно, создают функциональные связи с постнатально рожденными гранулированными клетками, включая центробежный ввод от обонятельной коры, митральных / пучковых клеток и SAC. Обширная связь, обеспечиваемая SAC с гранулированными клетками, поднимает вопрос об идентичности нейронов, которые являются пресинаптическими по отношению к SAC.Какие типы клеток управляют тормозящим влиянием, которое SAC, в свою очередь, передают на гранулярные клетки? Хотя было высказано предположение, что митральные клетки могут выполнять эту роль [24], прямые доказательства в поддержку этой модели отсутствуют. Будущее генетически ориентированное моносинаптическое отслеживание хорошо подходит для ответа на этот вопрос. Другим интригующим наблюдением стало вирусное мечение некоторых редких глиальных клеток, которые, как было установлено, находятся в прямом физическом контакте с гранулированными «исходными» клетками. Такое мечение могло быть связано с захватом вирусных частиц на контактах нейрон-глия.Действительно, новорожденные нейроны неокортекса, как известно, образуют временные щелевые контакты с радиальной глией [73], и были описаны функциональные нейронно-глиальные синапсы [74], [75]. Альтернативно, глиальное мечение может возникать за счет избирательного поглощения или поглощения клеточных остатков во время апоптоза или сокращения синапсов [76], [77]. В будущих исследованиях будет важно изучить электрофизиологическую и ультраструктурную природу этого взаимодействия нейронов с глией.

Распространение запаха расширяет схему обонятельной лампы

SACs рождаются во время эмбрионального развития и являются резидентными до сенсорного ввода или интеграции гранулярных клеток [35], [78].Таким образом, кластерная организация на гранулярных клетках может отражать события формирования паттерна развития, которые происходят во время созревания переднего мозга, или, альтернативно, может представлять локальную связность, которая вырабатывается или сокращается в ответ на паттерны сенсорного опыта или клубочковой активности. В нашей экспериментальной системе мы наблюдали кластерные входы SAC в гранулярные клетки как в нестимулированных контрольных группах, так и в группах, обогащенных запахом. Однако, помимо известного обогащения постнатальных нейронов, которые интегрируются в цепи обонятельной луковицы после стимуляции запахом [7], [31], мы обнаружили, что количество нейронов, формирующих функциональные пресинаптические входы в отдельные гранулярные клетки, также резко возрастает. усиливается после обогащения запаха.Этот повышенный уровень пресинаптического входа в исходные клетки постсинаптических гранул был обнаружен по большему количеству помеченных пресинаптических мишеней, морфологическим изменениям в постсинаптических структурах позвоночника и тормозных каркасов, а также по увеличению тормозящего влечения. Наличие большего количества пресинаптических входов в новорожденные GC не обязательно означает линейное увеличение межклеточной связи. То есть в ответ на стимуляцию запаха дополнительные типы пресинаптических клеток могут образовывать синаптические связи без общего изменения абсолютного числа синапсов на GC, при условии, что общий коэффициент связности для любой данной пресинаптической целевой клетки уменьшается.Хотя фокус нашего анализа был на увеличении количества входов в GC SAC, мы также наблюдали увеличение количества меченых пресинаптических митральных клеток (данные не показаны). Вероятно, что изменения, которые мы наблюдаем в клеточной морфологии и электрофизиологическом выходе в ответ на обогащение запаха, отражают совокупность расширенной связи не только со стороны SAC, но также митральных клеток и центробежных входов. В настоящем исследовании мы показали, что пресинаптические связи, создаваемые SAC на гранулярных клетках новорожденных, значительно увеличиваются в ответ на сенсорную стимуляцию, предполагая, что они играют ключевую роль в способности постнатальных нейронов интегрироваться в интактный мозг.Для будущих исследований будет важно детально определить, как весь репертуар пресинаптических входов настраивается сенсорным опытом. Таким образом, помимо увеличения количества вновь включенных гранулярных клеток [4], [7], [31], [79], сенсорный опыт привлекает дополнительные пресинаптические элементы, которые контактируют с каждой гранулярной клеткой. Такая усиленная интеграция может способствовать высокой степени клеточной пластичности в этой области мозга и улучшенному сенсорному различению, наблюдаемому при обогащении запаха [4].

Наши эксперименты с эксплантами на срезах предполагают, что синаптическая передача RV не зависит от потенциалов действия, VAMP-опосредованного синаптического высвобождения и быстрой глутаматергической нейротрансмиссии и, таким образом, отражает изменения в физических сетевых связях. В самом деле, стимуляция запаха увеличивает плотность шипов и тормозящие синапсы на новых гранулярных клетках, что согласуется с увеличением пресинаптического входа. Остается определить, приводят ли изменения контура, которые мы наблюдали в нашей экспериментальной парадигме, к долгосрочным структурным изменениям, которые сохраняются на протяжении всей жизни животного, или представляют собой временные связи, которые обрезаются или теряются в отсутствие постоянного ощущения запаха.Наш текущий метод маркировки пресинаптических входов необратим, и для будущих долгосрочных исследований по отслеживанию будет важно изучить временной ход пластичности цепи гранулярных клеток в ответ на обогащение запаха или депривацию. Такой анализ может потребовать новых технологий для повторной генетической маркировки пресинаптических партнеров на определенных популяциях клеток с течением времени.

Наше настоящее исследование продемонстрировало возможности новых генетических технологий для определения нейронных цепей in vivo .Обонятельная система — это необычно пластичная область мозга млекопитающих, способная непрерывно добавлять и удалять клеточные когорты с сопутствующим ремоделированием синапсов и цепей во взрослом возрасте. Наши результаты показывают, что сенсорный опыт способствует синаптической интеграции новых нейронов в обширные, пространственно организованные, специфичные для клеточного типа обонятельные цепи, обеспечивая управляемую модель in vivo , чтобы лучше понять, как активность влияет на формирование сложных нервных цепей. Более того, взрослые нейроны, обычно предназначенные для обонятельной луковицы, могут перенаправляться к участкам поражения в неокортексе и полосатом теле [80], [81], предполагая, что механизмы пластичности, врожденные для этого возобновляемого типа клеток, могут быть использованы для восстановления тканей.В более широком смысле, моносинаптическое отслеживание in vivo обеспечивает мощный подход к картированию глобальной связности недавно интегрированных нейронов во время развития, пластичности и регенерации.

Методы

Все экспериментальные процедуры и реагенты, использованные для этого исследования, были одобрены институциональными комитетами по уходу за животными и их использованию при Медицинском колледже Бейлора и Медицинском центре Университета Дьюка.

Конструкция плазмиды экспрессии

Для создания конструкции pCAG-Rabies G-IRES-TVA кДНК, кодирующая G бешенства, была вырезана из pHCMV-RabiesG [82] и клонирована в модифицированный остов pCIG [83].Для бицистронной экспрессии рецептора TVA кДНК TVA из pCMMP-TVA800 [84] амплифицировали с помощью ПЦР и клонировали ниже элемента IRES2 (Clontech, Mountain View, CA) для вставки 3 ‘в бешенство G. экспрессия рекомбиназы Cre, IRES-Cre [85] вставляли ниже G-IRES-TVA от бешенства для генерации pCAG-rabies G-IRES-TVA-IRES-Cre.

Поколение

ROSA26-stop flox -td Tomato Мыши

Фрагмент кДНК размером 1,6 т.п.н., кодирующий белок tdTomato (предоставленный Roger Tsien, UCSD), амплифицировали с помощью ПЦР и клонировали перед сигнальной последовательностью polyA pCRII.Конструкция tdTomato-polyA была проверена секвенированием. Затем мы сконструировали челночный вектор, сначала клонировав кДНК tdTomato-polyA в вектор pBigT [86] и вставив промоторный элемент CAG с использованием PacI перед последовательностью loxP-stop-loxP. Затем мы переместили кассету CAG-loxP-stop-loxP-tdTomato-polyA в плазмиду, нацеленную на акцептор pROSA, как описано ранее [87], чтобы получить вектор нацеливания ROSA-CAG-loxP-stop-loxP-tdTomato. Эта нацеленная конструкция была линеаризована и электропорирована в клетки E14 ES [88].После отбора клоны отбирали и проверяли на рекомбинированный аллель с помощью саузерн-блоттинга. Для саузерн-блоттинга геномную ДНК ES-клеток расщепляли EcoRV, переносили и гибридизовали с внешним зондом в локус ROSA26. Аллель дикого типа давал фрагмент размером 11,5 т.п.н., тогда как полоса 5,7 т.п.н. выявляла мутантный аллель. Используя стандартные процедуры [89], положительные клоны ES-клеток использовали для создания мышей, нацеленных на ген. Полученное потомство генотипировали с помощью ПЦР. Для обнаружения как аллелей дикого типа, так и целевых аллелей были разработаны следующие праймеры для ПЦР для мультиплексирования: Rosa / 01 , 5′-CACTTGCTCTCCCAAAGTCG -3 ‘; Rosa / 02 , 5′-TAGTCTAACTCGCGACACTG -3 ‘; CAG / 02 , 5′- GTTATGTAACGCGGAACTCC -3 ‘.Аллель дикого типа продуцировал фрагмент размером ~ 560 п.н. с праймерами Rosa / 01 и Rosa / 02 , тогда как мутантный аллель был обнаружен по фрагменту размером ~ 300 п.н. с праймерами Rosa / 01 и CAG / 02 .

Электропорация in vivo и мечение RV постнатальных гранулярных клеток

Новорожденных мышей анестезировали кратковременным переохлаждением. Затем 500 нл 1 мкг / мкл плазмидной ДНК, свободной от эндотоксина, вводили в одностороннем порядке в правый боковой желудочек с помощью шприца Hamilton с иглой 33-го размера со специальным скосом (Hamilton Company, Reno, NV).Электропорацию проводили путем приложения нескольких импульсов напряжения по ширине головы новорожденного, сразу позади глаз, с использованием круглых 7-миллиметровых пинцетов и прямоугольного электропоратора BTX ECM 830 (Harvard Apparatus, Холлистон, Массачусетс). Параметры электропорации включали 5 импульсов 150 В по 50 мс каждый с интервалом 950 мс. Сразу после процедуры электропорированных мышей возвращали в отапливаемую домашнюю клетку и наблюдали до выздоровления. Через 30 дней после процедуры электропорации 250 нл (6 × 10 3 частиц / мкл) псевдотипированного SADΔG-EGFP RV вводили в слой гранулярных клеток обонятельной луковицы с помощью стеклянных инъекционных пипеток и Nanoject II (Drummund Scientific Company , Брумолл, Пенсильвания).Мы направили инъекцию в середину обонятельной луковицы на 750 мкм ниже поверхности мозга. Это привело к заражению объемом ~ 300 мкм в диаметре ± 200 мкм (см. Рис. 1e). Через 7 дней после заражения обонятельные луковицы препарировали и готовили для анализа изображений.

Электропорация и культуры органотипических срезов

Органотипических срезов мозга получали и культивировали, как описано ранее [52], с небольшими модификациями. Для срезов ex vivo дорсальные предшественники телэнцефала метили путем инъекции плазмидной ДНК pCAG-Rabies G-IRES-TVA-IRES-Cre (0.1 мг / мл), разведенных в 0,1% растворе Fast Green, в боковые желудочки обезглавленных голов мышей E14.5 ROSA26-stop flox -tdTomato . Раствор доставляли с помощью небольшой стеклянной капиллярной пипетки, присоединенной к Picospritzer II (General Valve Corp., Фэрфилд, Нью-Джерси), с использованием пяти импульсов 15 фунтов на кв. Дюйм длительностью 4 мс каждый. Электрические потенциалы генерировались на неповрежденных головках с использованием покрытых золотом электродов, прикрепленных к электропоратору ECM 830 со следующими параметрами: четыре импульса по 100 мс 45 В, разделенные интервалами 100 мс.Сразу после электропорации мозг препарировали, делали срезы вибратомом на 250 мкм и сохраняли в качестве интерфейсных органотипических культур до фиксации и иммуногистохимического мечения. Для срезов острых обонятельных луковиц новорожденных мышей дикого типа подвергали электропорации, как описано выше, с ДНК-плазмидой, кодирующей EF1α-tdTomato-P2A-Rabies G-IRES-TVA-WPRE-pA. Через 10 дней мозг препарировали, делали срезы вибратомом на 250 мкм, инфицировали вирусом и поддерживали в качестве интерфейсных органотипических культур. На следующий день фармакологические агенты, включая один или несколько из TTX (1 мкМ, Sigma), ботулинический токсин A (50 нМ, Sigma), столбнячный токсин (50 нМ, Sigma), APV (50 мкМ, Tocris) или CNQX (50 мкМ , Tocris) добавляли к питательной среде и вводили повторно каждые 24 часа в течение 5 дней.Затем срезы фиксировали, визуализировали и подсчитывали для флуоресцентно меченных клеток.

Конфокальная визуализация и иммуногистохимия

Экспериментальных мышей умерщвляли, перфузировали 4% параформальдегидом в фосфатно-солевом буфере, препарировали для удаления интактного мозга и постфиксировали в течение 1 часа при 4 ° C. Ткань мозга помещали в O.C.T и либо делали срезы до 12 мкм на вертикальном криостате Leica, либо срезы 50–100 мкм нарезали на охлаждаемом микротоме столика. Срезы тканей помещали на предметные стекла и отображали с помощью вертикального сканирующего конфокального микроскопа Zeiss 510 (Carl Zeiss Inc.). Для иммуногистохимии срезы инкубировали с блокирующим раствором (10% нормальная козья сыворотка, 2% BSA, 0,1% Triton X-100 в PBS pH 7,4) и инкубировали при 4 ° C в течение 2 часов. Мышиный моноклональный антикалретинин (1-1500; Millipore, Temecula, CA), кроличьи поликлональные анти-GABA A α1 (1-1000; Covance), кроличьи поликлональные анти-GFAP (1-1500; Abcam, Cambridge, MA) , поликлональные антитела против парвальбумина морских свинок (1-500, Millipore, Temecula, CA), моноклональные антигефирины (1-2000; Synaptic Systems, Германия) или кроличьи поликлональные антитирозингидроксилазы (1-2000; Novus, Littleton, CO) антитела разводили в блокирующем растворе и наносили на ночь при 4 ° C.На следующий день срезы промывали 3 раза по 15 минут в PBS с 0,1% Triton X-100, а затем 2 раза по 15 минут в блокирующем растворе. Затем добавляли вторичные козьи антитела против кроличьего IgG к Alexa-633, ослиные антитела против мышиных антител Alexa-647 или козьи антитела против морских свинок Alexa-633 (Invitrogen, Carlsbad, CA) затем добавляли до конечного разведения 1-500 и инкубировали в течение 4 дней. ч при 4 ° C. Затем срезы промывали 4 × 15 мин каждый и наносили на DAPI-содержащую монтажную среду Vectashield (Vector Laboratories, Burlingame, CA). Иммунореактивные слайды отображались так же, как необработанные ткани.

Двойное иммунофлуоресцентное мечение BrdU и GFP.

Тонкие срезы 14–16 мкм были вырезаны на вертикальном криостате Leica и собраны на предметных стеклах Superfrost Plus. Слайды сушили на воздухе в течение 1 часа, повторно гидратировали в PBS и погружали в блокирующий раствор (описанный выше) на 1 час при комнатной температуре. Затем кроличьи антитела против GFP (1-500, Molecular Probes, CA) наносили на предметные стекла в блокирующем растворе в течение ночи при 4 ° C. На следующий день слайды промывали 3 раза по 5 минут каждое в PBS, после чего наносили антикроличий Alexa 488 (1-500, Molecular Probes, CA) в течение 1 часа при комнатной температуре.Затем предметные стекла промывали 3 раза по 5 минут каждое, после фиксировали в 4% PFA в течение 15 минут, промывали в PBS 3 раза по 5 минут каждое, погружали в 0,5N HCl при 55 ° C на 6 минут, затем снова фиксировали в 4%. PFA в течение 10 мин, затем промывали 3 раза по 5 мин в PBS. Затем слайды переваривали в растворе протеиназы К (0,5 мг / мл) при 37 ° C в течение 4 минут, затем фиксировали в 4% PFA в течение 15 минут, затем промывали 3 × 5 минут каждое в PBS. После последней промывки предметные стекла погружали в блокирующий раствор на 1 час при комнатной температуре, заменяли свежим блокирующим раствором, содержащим мышиный анти-BrdU (1∶200, Chemicon), и реагировали в течение ночи при 4 ° C.На следующий день слайды промывали 3 раза по 5 минут каждое, промывали блокирующим раствором, затем заменяли блокирующим раствором, содержащим антимышиный Alexa 594 (1-500, Molecular Probes, CA) в течение 1 часа при комнатной температуре. Наконец, слайды промывали 3 раза по 5 мин каждое, закрывали покровным стеклом и отображали для подсчета клеток.

Реконструкция 3D флуоресцентного изображения.

Для создания трехмерных изображений микросхем, меченных RV в обонятельной луковице, файлы изображений LSM, содержащие 50–75 плоскостей изображения z-стека из очищенных срезов мозга 150 мкм [61], разнесены на 1.На расстоянии 5 мкм обрабатывали с использованием программного обеспечения Amira для сегментации и объемного рендеринга (Visage Imaging, Сан-Диего, Калифорния). Плоскости изображения были получены при 20-кратном увеличении полного поля. Были реконструированы изолированные пресинаптические сети, включающие идентифицируемые одиночные исходные гранулярные клетки и их пресинаптические SAC. После отслеживания всех типов клеток, экспрессирующих EGFP, и выполнения сегментации, митральные клетки, меченные EGFP, и случайные gial клетки были замаскированы из реконструкции изображения, чтобы обеспечить лучшее разрешение изображения и измерение сетей SAC.Из-за неопределенности происхождения всех тонких нейритов, выходящих из поля изображения, измерения сетей SAC были ограничены четко определяемыми дендритами.

Анализ дендритных выступов.

Для количественной оценки количества выпячиваний, которые мы наблюдали на дендритах постнатальных гранулярных клеток после обогащения запаха, мы умерщвляли мышей из стимулируемой запахом и контрольной групп, выполняли внутрикардиальную перфузию, а затем фиксировали в течение 1 часа в 4% параформальдегиде в PBS.Ткань мозга подвергали криозащите в 30% сахарозе / PBS и замораживали в O.C.T. Тонкие срезы (20 мкм) вырезали на криостате и помещали на предметные стекла Superfrost Plus. С помощью вертикального конфокального микроскопа Zeiss 510 сначала были идентифицированы дендриты с двойной меткой (исходные клетки-гранулы), отходящие от RV-инфицированных гранулярных клеток при 40-кратном увеличении. Визуализация и анализ количества протрузий проводились в случайно выбранных сегментах дендритов с двойной меткой длиной 25 мкм в пределах внутреннего EPL. Были идентифицированы верхняя и нижняя границы дважды помеченных дендритных сегментов, и несколько конфокальных плоскостей изображения были собраны на расстоянии 250 нм друг от друга для создания отдельных файлов изображений z-стека с 40 плоскостями и толщиной 10 мкм, чтобы охватить всю толщину дендрита.Все подсчеты дендритных выступов проводились без учета экспериментальных манипуляций. Морфологический критерий, установленный для анализа, заключался в том, что длина выступа (ось, перпендикулярная стержню дендрита) была ≥ ширине выступа. Это было определено в 3-х измерениях путем ручной визуализации каждой плоскости серийных z-стопок для каждого дендритного сегмента, включенного в анализ. Данные были представлены в виде ± SEM числа шипов на дендрит 25 мкм на гранулярных клетках у мышей, подвергшихся циклическому воздействию одорантов (запаха), по сравнению с контрольными животными, не подвергавшимися запаху.p <0,001, t-критерий Стьюдента. Для отображения репрезентативные изображения дендритных сегментов, используемые для подсчета выступов, были созданы как максимальные проекции Z-стека.

Анализ синаптических точек.

Все подсчеты точек, положительных по гефирину, проводились без учета условий эксперимента. Чтобы количественно оценить изменения в количестве синаптических точек после стимуляции запахом, мы подготовили меченую вирусом ткань обонятельной луковицы, как описано выше, для анализа позвоночника. Вкратце, срезы 20 мкм были вырезаны и помещены на предметные стекла.С помощью вертикального конфокального микроскопа Zeiss 510 были идентифицированы дважды меченые дендриты, отходящие от инфицированных RV гранулярных клеток при 40-кратном увеличении. Были идентифицированы верхняя и нижняя границы дважды помеченных дендритных сегментов, и несколько конфокальных плоскостей изображения были собраны на расстоянии 250 нм друг от друга для создания отдельных файлов изображений z-стека с 40 плоскостями и толщиной 10 мкм, чтобы охватить всю толщину дендрита. Гефирин-положительные точки были идентифицированы и включены в наш анализ только в том случае, если они были четко разделены внутри клеток-источников гранул с двойной меткой.Это было определено путем визуализации вручную каждой плоскости последовательных z-стеков для каждого сегмента дендрита. Пункты считались колокализованными и подсчитывались, если окрашивание гефирином наблюдалось в ≥2 независимых плоскостях изображения через дважды меченый дендрит. Положительные по гефирину каркасы исключались из анализа, если они были ≥3 мкм в любом измерении. Данные были представлены в виде ± SEM количества гефирин-положительных точек на дендрит 35 мкм на гранулярных клетках у мышей, подвергшихся циклическому воздействию одорантов (запаха), по сравнению с контрольными животными, не подвергавшимися запаху.p <0,02, t-критерий Стьюдента. Для отображения репрезентативные изображения дендритных сегментов, используемых для подсчета гефирина, были созданы в виде максимальных проекций Z-стека.

Обогащение запаха

Обогащение запаха проводили с использованием параметров, аналогичных описанным ранее [90]. Для контролируемой доставки запаха робот-дозатор жидкости (модель 7200; I&J Fisnar, Fair Lawn, NJ) был запрограммирован на непрерывный цикл через 42 флакона, содержащие различные смеси одорантов, в течение 4 недель после электропорации.Отдушки подавали в течение 5 с каждый с последующей выдержкой на чистом воздухе в течение 1 мин при скорости потока 0,2 л / мин. Одоранты разбавляли минеральным маслом в соответствии с их индивидуальным давлением паров, чтобы получить номинальную концентрацию в свободном пространстве 100 ppm. Дальнейший поток разбавил одоранты до номинальной конечной концентрации паровой фазы ~ 10 ppm. Для смешанных стимулов соединения разбавляли до той же конечной концентрации доставки.

Электрофизиология срезов

Подготовка ломтика обонятельной луковицы.

Мышей умерщвляли пентобарбиталом натрия (40 мг / кг, внутрибрюшинно) и декапитировали после исчезновения роговичных рефлексов. Мозг быстро удаляли в ледяной буфер для препарирования, содержащий (в мМ): 87 NaCl, 2,5 KCl, 1,25 NaH 2 PO 4 , 25 NaHCO 3 , 75 сахарозы, 10 декстрозы, 1,3 аскорбиновой кислоты, 7 MgCl. 2 и 0,5 CaCl 2 , барботированный 95% O 2 и 5% CO 2 . В том же буфере для рассечения обонятельную луковицу изолировали и нарезали коронарно при 250 мкМ с помощью вибрирующего микротома (Leica VT1200S).Срезам давали возможность восстановиться в течение 20 минут при 35 ° C в ACSF, содержащем (в мМ): 124 NaCl, 3 KCl, 1,25 Na 2 PO 4 , 26 NaHCO 3 , 1 MgCl 2 , 2 CaCl 2 и 20 D-глюкоза, насыщенная 95% O 2 и 5% CO 2 , ~ 310 мОсм, pH ~ 7,25, и хранили при комнатной температуре до использования. Запись проводилась в погружной камере при 30–32 ° C в ACSF.

Записи всей клетки.

Клетки с коротким аксоном или исходные гранулярные клетки новорожденного были визуально идентифицированы с помощью оптики IR-DIC, а затем нацелены для регистрации либо с помощью EGFP, либо с помощью двойной флуоресценции EGFP и tdTomato, соответственно.Пипетки-патчи были извлечены из толстостенного боросиликатного стекла с сопротивлением открытого конца 2-7 МОм и были заполнены (в мМ) 120 K-глюконатом, 5 KCl, 2 MgCl 2 , 0,05 EGTA, 10 HEPES, 2 Mg- АТФ, 0,4 Mg-GTP, 10 креатининфосфат, pH 7,3, 280–290 мОсм, внутренний раствор для экспериментов с токовым зажимом для характеристики вызванного потенциала действия в коротких аксонных клетках. Для экспериментов с фиксацией напряжения для регистрации mIPSC в меченых новорожденных гранулярных клетках внутренний раствор был (в мМ) 89 CsMeS, 46 CsCl, 1 MgCl 2 ,0.16 CaCl 2 , 0,2 EGTA, 15 HEPES, 4 Na-ATP, 0,4 Na-GTP, 15 TEA-Cl, 14 креатининфосфат, pH 7,3, 315 мОсм. Для регистрации mIPSC клетки зажимали при -80 мВ и перфузировали в ванне 50 мкМ APV, 50 мкМ CNQX и 1 мкМ TTX. Клетки регистрировали с использованием усилителя патч-зажима (Multiclamp 700A, Molecular Devices), а данные собирали и анализировали с использованием программного обеспечения pCLAMP 10 (Molecular Devices) и Minianalysis (Synaptosoft).

Дополнительная информация

Рисунок S1.

Условный репортерный аллель в сочетании с отслеживанием моносинаптических цепей. (a) Схема вектора наведения ROSA26-stop flox -tdTomato . Расщепление EcoRV использовали для идентификации положительных клонов с помощью саузерн-блоттинга с использованием радиоактивно меченного зонда в указанной области. (b) Слева, Саузерн-блот-анализ, показывающий положительно нацеленный клон, обозначенный дополнительной полосой 5,7 т.п.н., полученной введением дополнительного сайта EcoRV в нацеливающий вектор; справа — данные генотипирования ПЦР с использованием прямого (For) и обратного (Rev) праймеров, как указано в (а), выявляющие присутствие целевого нокаутного аллеля у гетерозиготных и гомозиготных мышей ROSA26-stop flox -tdTomato .+, дикий тип; tgt, нокаутный аллель. (c) Эксплантат кортикального среза мыши ROSA26-stop flox -tdTomato после электропорации конструкции rabies-G-IRES-TVA-IRES-Cre в боковой желудочек. Обратите внимание на высокий уровень однородной экспрессии tdTomato после введения Cre. (d) Экспрессия SADΔG-EGFP в том же срезе, показанном на (c), через три дня после применения RV. (e) Объединенное флуоресцентное изображение условной экспрессии tdTomato и SADΔG-EGFP, показанное на (c) и (d).Шкала шкалы 1 мм. (f – h) Увеличенное изображение транссинаптически маркированной кортикальной микросхемы. Масштабная линейка 10 мкм. (f) Условная экспрессия tdTomato в нейронах коры, которые получили конструкцию экспрессии G-IRES-TVA-IRES-Cre. (g) Экспрессия SADΔG-EGFP в локальной сети кортикальных клеток, транссинаптически меченных RV. (h) Объединенное изображение, показывающее первоначально инфицированную исходную клетку (желтый) и местных пресинаптических партнеров (зеленый). (i) Объединенное изображение широко распространенной экспрессии репортера в корковых слоях рекомбинированного и инфицированного эксплантата среза.Обратите внимание на обширную пресинаптическую маркировку (зеленый) от ограниченного числа исходных клеток (желтый). Стрелки обозначают меченые исходные клетки; L5, слой 5. Масштабная линейка 10 мкм. Анализ меченых клеток проводили на n = 24 срезах от 12 эмбрионов.

https://doi.org/10.1371/journal.pone.0029423.s001

(TIF)

Рисунок S2.

Электропорация нацелена на постнатальные нейроны для стабильной интеграции плазмиды, но не на их предшественников стволовых клеток. (a) Стратегия маркировки для определения того, содержат ли гранулярные клетки, рожденные после электропорации (EP), стабильно интегрированную экспрессирующую конструкцию.Новорожденных мышей подвергали электропорации с помощью конструкции G-IRES-TVA-IRES-Cre и 14 дней спустя обрабатывали BrdU в воде клетки в течение дополнительных 14 дней, чтобы пометить все нейроны, рожденные после этого. Через 28 дней после электропорации мышам инъецировали SAD Δ G EGFP RV в обонятельную луковицу, а затем через 1 неделю обрабатывали для получения двойных изображений BrdU и EGFP. (b) Венечный срез обонятельной луковицы, показывающий маркировку BrdU. (c) Экспрессия SAD Δ G EGFP в срезе, показанном на (a). (d) Объединенное изображение (a) и (b).GL — гломерулярный слой; ЭПЛ, внешний плексиформный слой; MCL, слой митральных клеток; GCL, гранулированный клеточный слой. Масштабная линейка, 50 мкм. (e) График, показывающий отсутствие нейронов, меченных BrdU, экспрессирующих SAD Δ G EGFP, что указывает на то, что стабильная экспрессия G-IRES-TVA-IRES-Cre не распространяется в предшественниках стволовых клеток. * p <0,01, n = 3 луковицы.

https://doi.org/10.1371/journal.pone.0029423.s002

(TIF)

Рисунок S3.

Экспрессия SADΔG-EGFP в пресинаптических входах в гранулярные клетки. (a) — (e) Срезы мозга мышей после внутрижелудочковой инъекции и электропорации с использованием Rabies-G-IRES-TVA и последующей инфекции в слое гранулярных клеток обонятельной луковицы через 30 дней с помощью SADΔG-EGFP RV. Такой подход обеспечивает селективную SADΔG-EGFP RV-инфекцию гранулярных клеток новорожденных. (а) Экспрессия вирусного вектора SADΔG-EGFP в нейронах переднего обонятельного ядра (AON), указывающая на моносинаптический перенос от инфицированных гранулярных клеток OB. Экспрессию tdTomato можно наблюдать в обонятельной луковице (OB).Вставка в рамке соответствует виду с большим увеличением, показанному на (c). Масштабная линейка 300 мкм. (б) Экспрессия вирусного вектора SADΔG-EGFP в ядре горизонтальной конечности нейронов ядра диагональной полосы (HDB) и грушевидной коры (PCTX). Левая вставка соответствует виду с большим увеличением, показанному на (d), тогда как правая вставка соответствует (e). Масштабная линейка, 350 мкм. (c) Экспрессия SADΔG-EGFP в нейронах AON. (d) Экспрессия SADΔG-EGFP в нейронах HDB. (e) Экспрессия SADΔG-EGFP в нейронах грушевидной коры.Масштабные линейки (c) — (e), 50 мкм.

https://doi.org/10.1371/journal.pone.0029423.s003

(TIF)

Рисунок S4.

Роботизированная система доставки запахов. (a) Изображение роботизированной системы, предназначенной для циклической принудительной подачи одоранта воздухом. Робот был запрограммирован на непрерывный цикл через несколько флаконов, содержащих соединения с летучим запахом, в течение 30 дней после электропорации. (b) Список летучих соединений запаха, которые неоднократно доставлялись мышам, предназначенным для моносинаптического отслеживания микросхем обонятельной луковицы.

https://doi.org/10.1371/journal.pone.0029423.s004

(TIF)

Рисунок S5.

Блокада синаптической активности не влияет на передачу вируса бешенства. (a) — (e) Моносинаптическое мечение в культивируемых срезах обонятельных луковиц, полученных от мышей, подвергнутых электропорации in vivo с плазмидой, кодирующей tdTomato, Rabies G и TVA, с последующим инфицированием in vitro с SAD Δ G-EGFP и лечение фармакологическими блокаторами синаптической активности.Во всех условиях среза гранулярные клетки, восприимчивые к инфекции RV, помечены красным, исходные гранулярные клетки помечены красным и зеленым (желтый, стрелки), а пресинаптические входные клетки помечены зеленым. (а) Контрольный срез без фармакологической обработки. Срезы, обработанные ботулотоксином (BoTX, 50 нМ) (b), столбнячным токсином (TeTN, 50 нМ) (c), тетродотоксином (TTX, 1 мкМ) (d) или 50 мкМ CNQX плюс 50 мкМ APV (e). Масштабная линейка 150 мкм. (f) График, суммирующий среднее количество пресинаптических входных клеток, наблюдаемых на каждую меченую гранульную исходную клетку.Данные представляют собой средние значения ± стандартная ошибка среднего для всех меченых пресинаптических входных клеток, подсчитанных в 6 срезах для каждого условия. Существенных различий по сравнению с контролем не наблюдалось.

https://doi.org/10.1371/journal.pone.0029423.s005

(TIF)

Просеивание зрительной информации в верхнем холмике

Сводка приемки:

В документе показаны явные изменения в свойствах кодирования между входным и глубоким слоями верхнего холмика.Они особенно интересны в связи с потребностью животного сохранять информацию о соответствующих аспектах входных стимулов, отбрасывая другие. Подобные изменения в кодировании происходят во многих сенсорных цепях, и работа, подобная описанной в статье, может помочь в исследовании других цепей.

Письмо с решением после экспертной оценки:

Благодарим вас за отправку вашей статьи «Просеивание визуальной информации в верхних холмиках» на рассмотрение eLife .Ваша статья была рецензирована тремя рецензентами, включая Фреда Рике в качестве редактора-рецензента и рецензента №1, а оценку контролировал Джошуа Голд в качестве старшего редактора.

Рецензенты обсудили рецензии друг с другом, и редактор-рецензент подготовил это решение, чтобы помочь вам подготовить исправленную заявку. Хотя рецензенты с энтузиазмом отнеслись к заданным вопросам, некоторые проблемы ограничили энтузиазм и помешали провести полную оценку работы:

1) Ряд ключевых выводов в статье подтверждается данными из очень небольшого числа, в некоторых случаях отдельных ячеек.Конкретные примеры можно найти в отдельных обзорах, прилагаемых ниже. Рецензенты считали, что они не могут оценить значимость работы без такого популяционного анализа. К этому моменту каждый рецензент пришел независимо и подчеркнул в ходе консультаций с рецензентами.

2) Представленные популяционные анализы показывают существенное перекрытие между популяциями sSC и dSC. Текст представляет собой более дискретное описание этих данных и, как результат, неточно передает перекрытие в свойствах ответа между sSC и dSC нейронами.Важно, чтобы текст точно отражал степень сходства / различия в ответах sSC и dSC (и перекрытие популяционных анализов, таких как гистограммы на рисунках 2 и 4).

Все три рецензента согласились, что адекватное рассмотрение этих вопросов будет иметь важное значение для успешного пересмотра.

Рецензент № 1:

В этой статье исследуется, как представление визуальных входов изменяется, когда сигналы проходят через верхний холмик (SC). Акцент в статье делается на том, как развиваются три аспекта реакции на поведенческие стимулы: избирательность, позиционная инвариантность и привыкание.Изменения в кодирующих свойствах, аналогичные описанным здесь, происходят в других сенсорных цепях, и, следовательно, исследование этих изменений в SC, вероятно, обеспечит широкое понимание сенсорной обработки — точка, которая четко сформулирована в статье. Документ в целом в хорошем состоянии, но я чувствовал, что некоторые аспекты можно усилить:

Анализ населения.

Большинство основных положений документа хорошо подтверждены популяционным анализом. Такой анализ принесет пользу еще нескольким пунктам:

— пространственно-временной шум.Отсутствие ответов на шумовые стимулы в нейронах dSC по сравнению с нейронами sSC является дополнительным доказательством повышения избирательности. В настоящее время это показано для одного примера нейронов на рисунке 2. Можете ли вы добавить результаты популяции — например, от чего-то вроде скорости стрельбы до шумового стимула (возможно, нормированного на реакцию на расширяющееся темное пятно) в зависимости от глубины?

— передача сигналов SC без коры. На рис. 4 показан пример сохранения привыкания к нейрону SC, зарегистрированного у мыши, у которой отсутствует большая часть коры головного мозга.Можете ли вы проанализировать это во всех записанных ячейках? Сохраняются ли у этих мышей позиционная инвариантность и избирательность к надвигающемуся стимулу? Это подчеркнутый момент в статье, поэтому его следует изучить более подробно и предоставить информацию о популяциях клеток.

— Локальные датчики приближения. На рис. 6 — дополнение к рисунку 1 показан пример ячейки со свойствами, соответствующими локальным детекторам маяка, которые составляют основу предлагаемой модели. Модель предполагает, что таких ячеек много.Это единственный встреченный? Некоторое обсуждение требуемой плотности этих ячеек и зарегистрированного количества очень важно. Это особенно верно, потому что в статье приводятся доводы против некоторых альтернативных моделей, основанных на отсутствии необходимых типов клеток.

Описание ответов ганглиозных клеток сетчатки

В статье в нескольких местах утверждается, что зарегистрированные нейроны обладают свойствами, которые отличаются от свойств входов ганглиозных клеток сетчатки в SC (например, подраздел «Появление новых свойств ответа от поверхностных к глубоким слоям», последний абзац и подраздел «Рабочая модель для схема механизмов визуального просеивания », абзац первый).Было бы весьма полезно предоставить краткое изложение, в идеале в начале статьи, соответствующих свойств ответа RGC, чтобы можно было оценить / оценить отмеченные различия.

Модель.

Модель является хорошим дополнением к статье и дает четкий способ связать результаты с аналогичными свойствами кодирования в других сенсорных цепях. Однако я чувствовал, что альтернативные модели были отклонены слишком сильно (например, Введение, последний абзац; подраздел «Рабочая модель для схемных механизмов визуального просеивания», последний абзац; Обсуждение, первый абзац).Например, казалось бы возможным отменить ответ On предложенной схемы DS (например, используя сигналы от ячеек On DS). Точно так же предложенная тонически активная тормозная клетка, которая может обеспечить привыкание, отвергается, потому что ее не наблюдают (но, похоже, также наблюдается очень мало локальных детекторов маяка; см. Комментарий выше). Я бы предложил несколько менее решительно исключать эти модели (но я согласен с тем, что предлагаемая модель является наиболее вероятной из описанных).

Рецензент № 2:

Рукопись рассказывает интересную историю о различных визуальных реакциях на надвигающиеся темные стимулы в поверхностных и глубоких слоях верхнего холмика мыши.В нем описывается, что в dSC нейроны более избирательно активируются темными надвигающимися стимулами по сравнению с удаляющимися белыми стимулами, менее избирательны в отношении локализации стимула и более подавлены при повторной стимуляции даже в новых местах. Авторы представляют экономную трехуровневую сетевую модель, использующую синаптическую депрессию для объяснения депрессии, специфичной для местоположения. Газета очень удобна для чтения и представляет собой интересную историю. В целом, рукопись в некоторой степени страдает от того, что иногда даются только анекдотические свидетельства и различия в распределении представлены в виде черно-белых различий между sSC и dSC.

«Подавление не было постоянным». Показан только один пример. Пожалуйста, добавьте описание населения или статистику.

«Стимул в одном месте не подавил последующую реакцию.… (Рисунок 4C)». Для подтверждения этого утверждения показан только один пример нейрона. Пожалуйста, добавьте описание населения и статистику.

«Примечательно, что мутант продемонстрировал такое же длительное подавление…» Снова показан только один пример. Пожалуйста, добавьте количественную оценку и статистику.

«Опять же, в данных не наблюдалось». Опять же, показан только один пример, и на изображении действительно трудно наблюдать продолжающееся срабатывание базовой линии. Пожалуйста, добавьте количественную оценку, чтобы сделать это менее анекдотичным.

Рецензент № 3:

В рукописи представлены внеклеточные записи поверхностных и промежуточных / глубоких слоев SC у мышей с неподвижной головой в состоянии бодрствования, способных бегать по беговой дорожке и видеть либо мерцающий стимул в виде шахматной доски, либо один из нескольких визуальных паттернов (черные или белые приближающиеся или удаляющиеся стимулы и движущаяся черная точка).Вопрос в том, какова избирательность этих визуальных паттернов в SC и увеличивается ли эта избирательность в более глубоких слоях. Вопрос мотивирован поведенческими наблюдениями, полученными в этой и других лабораториях, о том, что врожденное защитное поведение может быть вызвано одними стимулами (например, надвигающимся черным диском), но не другими (например, удаляющимся белым диском).

Фундаментальное наблюдение состоит в том, что большинство визуальных паттернов, кажется, вызывают устойчивые ответы в поверхностном SC, но они не вызывают устойчивых ответов в более глубоких SC, за исключением начальных представлений черного надвигающегося диска.Вдобавок ответы на поверхностных слоях ограничены небольшими областями визуального пространства, но на более глубоких уровнях могут быть вызваны из больших областей визуального пространства. Авторы показывают, что в более глубоких SC ответы на черные вырисовывающиеся диски быстро привыкают, и что это привыкание является пространственно специфичным (таким образом, предположительно, на входе в эти более глубокие SC нейроны). Предлагается простая модель, чтобы связать эти наблюдения.

Бумага легко читается, а на рисунках данные представлены в доступной форме.Большинство представленных анализов выглядят уместными и хорошо выполненными. Однако представленный анализ не дает достаточного понимания и требует уточнения.

Основное утверждение состоит в том, что визуальная информация просеивается в холмике, причем более глубокие слои демонстрируют гораздо большую избирательность в отношении стимулов, которые могут иметь отношение к поведению (надвигающийся черный диск). Однако существует так мало анализа избирательности стимулов, что невозможно судить о правдивости утверждения. Единственное представленное количественное свидетельство, я думаю, — это сравнение реакции на белые удаляющиеся диски и черные приближающиеся диски на Рисунке 2C.Существует небольшая, хотя и значительная разница в распределениях в поверхностных и более глубоких слоях, но распределения полностью перекрываются. Этой статистической разницы в одном сравнении недостаточно, чтобы подтвердить утверждение о «просеивании». Необходим анализ всего пространства для ответов — и если различия остаются такими же незначительными, как на рис. 2C, тогда необходимо некоторое смягчение утверждений о наличии сильных различий в избирательности. В связи с этим, амплитуда ответа, по-видимому, существенно снижается в более глубоких слоях, и один из способов увеличения селективности — это если надвигающиеся черные диски будут более способны управлять ответами по всей SC, но нейроны в более глубоких слоях имеют более высокий порог для активация.

Второе утверждение состоит в том, что нейроны в более глубоких SC имеют гораздо большие области активации; это подтверждается красивым анализом на Рисунке 3, который показывает прогрессивное увеличение области активации черного вырисовывающегося стимула для нейронов в более глубоких слоях. Я хотел бы знать, было ли это специфичным для стимулов, нависающих над черным, или также для других стимулов — в тех нейронах, которые на них реагировали, но это потребовало бы значительного количества экспериментов и не является достижимой целью.

Третье утверждение состоит в том, что нейроны в более глубоких SC привыкают сильнее, чем в поверхностных SC. Рисунки 4B и D предполагают, что большинство нейронов как в поверхностных, так и в более глубоких слоях демонстрируют привыкание в течение времени <10 секунд, но что в среднем привыкание сильнее и длится дольше в более глубоких слоях. Возможно, самым приятным результатом здесь является пространственная специфика привыкания, наблюдаемая в более глубоких слоях, что подразумевает «восходящую» десенсибилизацию входных сигналов к этим нейронам. Расшифровка, представленная на Рисунке 5, потеряла меня здесь - текст вокруг десятого абзаца подраздела «Анализ» не особенно информативен, и я не уверен, как выводятся уровни вероятности, и как конкретный выбор анализа (который включает в себя пространственную репликацию). сдвинутые копии записанных нейронов) могут повлиять на результат, и даже на то, сколько нейронов в каждой области (поверхностной / глубокой) было в исходных 3 наборах данных.Этот раздел требует существенного пояснения.

[Примечание редакции: до принятия были предложены дальнейшие исправления, как описано ниже.]

Спасибо, что повторно отправили вашу статью «Просеивание визуальной информации в верхних холмиках» на рассмотрение eLife . Ваша отредактированная статья была рассмотрена тремя рецензентами, включая Фреда Рике в качестве редактора-рецензента и рецензента №1, а оценку контролировал Джошуа Голд в качестве старшего редактора.

Рецензенты обсудили рецензии друг с другом, и редактор-рецензент подготовил это решение, чтобы помочь вам подготовить исправленную заявку. Все рецензенты оценили исправления и посчитали, что они сделали статью значительно сильнее. Остается несколько существенных вопросов, о которых говорится в отдельных обзорах ниже.

Рецензент № 1:

Это повторное представление статьи, в которой сравнивается представление сенсорных стимулов в поверхностных и глубоких слоях верхнего холмика.Основная проблема оригинальной статьи заключалась в отсутствии данных о населении и соответствующих статистических тестов основных выводов. Эти вопросы в значительной степени рассмотрены, и документ намного сильнее. У меня есть еще несколько предложений для ясности изложения.

Рецензент № 2:

Авторы удовлетворительно ответили на все мои вопросы и предложения.

Однако в добавлении, сделанном в ответ на один из моих вопросов, была внесена небольшая ошибка.На новой панели рисунка 4C внизу справа с 30 клетками dSC упоминается, что ответы «нормализованы по ответу на первое испытание пурпурного следа». Это действительно кажется разумным. Однако первая точка на синей кривой — ровно 1 (не приблизительно, я проверял в Illustrator). Сделана ли здесь ошибка в нормализации или в описании, или она была настолько близка к 1, что округление поставило ее ровно на 1? В тексте нет цифр или статистики, поэтому у меня не было возможности проверить этот момент.

Рецензент № 3:

Пересмотр касается большинства вопросов, поднятых рецензентами, в том числе и мной. Бумага сильнее и представляет более убедительную историю. У меня остались вопросы.

1) Я ценю предоставление более описательных обзоров некоторых наборов данных. Однако в Резюме утверждается: «нейронные реакции становятся более избирательными в отношении поведенчески значимых стимулов»), а в начале Обсуждения — «возрастающая избирательность к поведенчески значимому вырисовывающемуся стимулу по сравнению с другими безобидными стимулами с аналогичными низкоуровневыми характеристиками (рис. 2) «) по-прежнему полагаются только на 2 сравнения активности (черный ткацкий станок vs.шахматная доска и черный ткацкий станок против отступающего белого). Еще 4 набора данных представлены для примеров нейронов на рисунке 2, но не анализируются далее. Ранее я предлагал провести полный анализ этого пространства ответов, что, по мнению авторов, невозможно в одном отчете. Но метрику отклика для этих наборов данных получить несложно, и я не могу понять, почему авторы не могут представить (возможно, в виде таблицы в дополнительных данных, сопровождающих рисунок 2) соответствующий многомерный анализ. В качестве альтернативы, текст можно изменить, чтобы прояснить, что утверждения основаны на сравнении популяций для двух стимулов, а также на шахматной доске.

2) Независимо от того, что думают авторы по поводу вышеизложенного, в отношении подраздела «Селективность стимула», я думаю, авторы выводят реакцию на шахматную доску из средней скорости по всей презентации стимула шахматной доски (т.е. несколько минут), в то время как ответ на стимул ткацкого станка — это количество шипов в первом предъявлении (то есть в первой секунде). Если я ошибаюсь, поясните. Если это не так, то, если реакции привыкают к шахматной доске, как к ткацкому станку, тогда это нечестное сравнение, и сопутствующий анализ с использованием тех же временных рамок для обоих стимулов был бы уместен.

3) Использование слова «новинка» в легенде на Рисунке 5 и в последнем абзаце подраздела «Привыкание к знакомым стимулам» остается неясным для читателя, и необходимо внести ясность в основной текст, что новизна здесь означает новое. Место не новой формы. Это нетривиальное различие.

https://doi.org/10.7554/eLife.50678.sa1 .

alexxlab

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *